Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22390 Copy
Species: Mus musculus
Genetic Insert: Seryl tRNA synthetase (SRS) – mouse cytoplasmic dynein microtubule binding domain (MTBD) fusion protein
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:0; Vector Backbone:pET42a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_22391 Copy
Species: Mus musculus
Genetic Insert: p65 shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse p65 (RelA) shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGAATCCAGACCAACAATAATTCAAGAGATTATTGTTGGTCTGGATTCTTTTTTC
reverse oligo :
TCGAGAAAAAAGAATCCAGACCAACAATAATCTCTTGAATTATTGTTGGTCTGGATTCA
Proper citation: RRID:Addgene_22507 Copy
Species: Mus musculus
Genetic Insert: p65 shRNA2
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse p65 (RelA) shRNA2 in pSicoReverse (Puromycin)
forward oligo:
TGCATGCGATTCCGCTATAATTCAAGAGATTATAGCGGAATCGCATGCTTTTTTC
reverse oligo :
TCGAGAAAAAAGCATGCGATTCCGCTATAATCTCTTGAATTATAGCGGAATCGCATGCA
Proper citation: RRID:Addgene_22508 Copy
Species: Mus musculus
Genetic Insert: cRel shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#11579); Backbone Size:7500; Vector Backbone:pSicoR GFP; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse cRel shRNA1 in pSicoReverse (GFP)
forward oligo:
TGGAATGCGGTTTAGATACATTCAAGAGATGTATCTAAACCGCATTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGAATGCGGTTTAGATACATCTCTTGAATGTATCTAAACCGCATTCCA
Proper citation: RRID:Addgene_22509 Copy
Species: Mus musculus
Genetic Insert: IkBSR
Vector Backbone Description: Backbone Marker:Available at Addgene (#20905); Backbone Size:8609; Vector Backbone:UbC.Luciferase.PGK.Cre; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse IkappaBalpha super repressor, Flag tagged (C-terminus). Cloned EcoRI-NotI in UbC.Luciferase.PGK.Cre vector in place of Luciferase: UBC promoter-Kozak-IkBaSR-Flag-STOP—PGK promoter-Cre.
Proper citation: RRID:Addgene_22503 Copy
Species: Mus musculus
Genetic Insert: IkBSR
Vector Backbone Description: Backbone Size:8000; Vector Backbone:pCW22TRE_PGKCre vector; Vector Types:Mammalian Expression, Lentiviral, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse IkappaBalpha super repressor, Flag tagged (C-terminus). Cloned EcoRI in pCW22TRE_PGKCre vector : TRE promoter-Kozak-IkBaSR-Flag-STOP—PGK promoter-Cre
Proper citation: RRID:Addgene_22504 Copy
Species: Mus musculus
Genetic Insert: NEMO shRNA2
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse NEMO shRNA2 in pSicoReverse (Puromycin)
forward oligo:
TGGACAAGGCCTCTGTGAAATTCAAGAGATTTCACAGAGGCCTTGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACAAGGCCTCTGTGAAATCTCTTGAATTTCACAGAGGCCTTGTCCA
Proper citation: RRID:Addgene_22506 Copy
Species: Mus musculus
Genetic Insert: cRel shRNA2
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse cRel shRNA2 in pSicoReverse (Puromycin)
forward oligo: TGCCTCATCCTCATGATTTATTCAAGAGATAAATCATGAGGATGAGGCTTTTTTC
reverse oligo :
TCGAGAAAAAAGCCTCATCCTCATGATTTATCTCTTGAATAAATCATGAGGATGAGGCA
Proper citation: RRID:Addgene_22510 Copy
Species: Mus musculus
Genetic Insert: PIF3NT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5369; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22475 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta 745
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22640 Copy
Species: Mus musculus
Genetic Insert: Ror2 Y645F
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22636 Copy
Species: Mus musculus
Genetic Insert: Ror2 Y646F
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22637 Copy
Species: Mus musculus
Genetic Insert: Ror2 Y641,645,646F
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22638 Copy
Species: Mus musculus
Genetic Insert: Ror2 N620K
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22631 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta ST1
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22632 Copy
Species: Mus musculus
Genetic Insert: Ror2 delta ST2
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22633 Copy
Species: Mus musculus
Genetic Insert: Ror2 WT
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_22613 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6360; Vector Backbone:pBIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Myt1 central domain insert. bp 2035-2739 and aa 502-736. Used for Mammalian 2-hybrid assay
This Myt1 DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22654 Copy
Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6360; Vector Backbone:pBIND; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: First 1/2 of Myt1 central domain. bp 2035-2399 and aa 602-623. Used for Mammalian 2-hybrid assays
This Myt1 DNA cloned by Hudson lab.
Proper citation: RRID:Addgene_22655 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
