Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pSCD-GSDMA-N Resource Report Resource Website |
RRID:Addgene_226234 | Gasdermin A | Mus musculus | Ampicillin | PMID:38657604 | Vector Backbone:pZAG30; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:02:03 | 0 | ||
|
pHR-TRE-MyoD-P2A-miRFP703_PGK-Puro Resource Report Resource Website |
RRID:Addgene_216666 | MyoD | Mus musculus | Ampicillin | Backbone Size:9591; Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 01:02:04 | 0 | |||
|
pTwist-msEEA1 Resource Report Resource Website |
RRID:Addgene_214991 | EEA1 | Mus musculus | Kanamycin | Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/. | Vector Backbone:pTwist Entr; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-07-25 01:00:24 | 0 | ||
|
Anti-Neuroligin-2 [L107/95R] Resource Report Resource Website |
RRID:Addgene_188184 | anti-Neuroligin-2 (Mus musculus) recombinant mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2916210. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:36 | 0 | |
|
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs Resource Report Resource Website |
RRID:Addgene_195018 | CCGTATAGGCGGCTGCCCAA | Mus musculus | Ampicillin | PMID:36798245 | Backbone Marker:NIDA GEVVC; Backbone Size:6400; Vector Backbone:pOTTC1553; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:37 | 0 | ||
|
pGFP-mTet1s pc3901 Resource Report Resource Website |
RRID:Addgene_201700 | Tet1s | Mus musculus | Ampicillin | PMID:36056023 | Backbone Size:6977; Vector Backbone:GFP Tet1 full-length (pc2271); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:38 | 0 | ||
|
pmcherry-mTet1s pc3905 Resource Report Resource Website |
RRID:Addgene_201703 | Tet1s | Mus musculus | Ampicillin | PMID:36056023 | Backbone Size:9322; Vector Backbone:GFP-Uhrf1 (pc1756); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:38 | 0 | ||
|
pGFP-mTet1s_K852E pc3915 Resource Report Resource Website |
RRID:Addgene_201705 | Tet1s-K852E | Mus musculus | Ampicillin | PMID:36056023 | Backbone Size:9095; Vector Backbone:GFP-tagged construct encoding the catalitic domain of Tet1 (pc2315); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Lysine 852 mutated to glutamate | 2026-07-25 01:00:38 | 0 | |
|
pmcherry-mVprBP pc2954 Resource Report Resource Website |
RRID:Addgene_201699 | VprBP | Mus musculus | Ampicillin | PMID:36056023 | Backbone Size:9322; Vector Backbone:mCherry Uhrf1 (pc1756); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:38 | 0 | ||
|
Anti-GFP [N86/38R-1] Resource Report Resource Website |
RRID:Addgene_206719 | anti-GFP (Aequorea victoria) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941290. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:41 | 0 | |
|
Anti-Homer1L [L113/27R-1] Resource Report Resource Website |
RRID:Addgene_206688 | anti-Homer1L (Mus musculus) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941259. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:41 | 0 | |
|
Anti-AMIGO-1 [L86/33R-1] Resource Report Resource Website |
RRID:Addgene_206695 | anti-AMIGO-1 (Mus musculus) recombinant Mouse monoclonal antibody | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant antibody derived from RRID: AB_2941266. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:41 | 0 | |
|
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_209196 | Cnr1 | Mus musculus | Ampicillin | PMID:37480845 | Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:42 | 1 | ||
|
LMPd Amt LDHA Resource Report Resource Website 1+ mentions |
RRID:Addgene_209408 | LdhA shRNA | Mus musculus | Ampicillin | PMID:35981545 | Backbone Marker:Chen et al. 2014; Vector Backbone:LMPd Amt; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:42 | 1 | ||
|
LMPd Amt PHGDH Resource Report Resource Website 1+ mentions |
RRID:Addgene_209409 | Phgdh shRNA | Mus musculus | Ampicillin | PMID:31747582 | Backbone Marker:Chen et al. 2014; Vector Backbone:LMPd Amt; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:42 | 1 | ||
|
Anti-Neurabin-1/Ppp1r9a [L129/96R] Resource Report Resource Website |
RRID:Addgene_211583 | anti-Neurabin-1/Ppp1r9a (Mus musculus) recombinant mouse monoclonal antibody. | Mus musculus | Ampicillin | PMID:37758930 | This is a recombinant monoclonal antibody RRID: AB_3073576Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute. | Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 01:00:43 | 0 | |
|
pAS2-mCALEBcyt (aa 465-539) Resource Report Resource Website |
RRID:Addgene_89408 | CSPG5 | Mus musculus | Ampicillin | Backbone Marker:ATCC; Vector Backbone:pAS2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | aa 465-539 | 2026-07-25 12:53:34 | 0 | ||
|
pAS2-mCALEBlong.cyt (aa 522-594) Resource Report Resource Website |
RRID:Addgene_89409 | CSPG5 | Mus musculus | Ampicillin | Backbone Marker:ATCC; Vector Backbone:pAS2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | aa 522-594 | 2026-07-25 12:53:34 | 0 | ||
|
pAS2-mCALEBsplice.cyt (aa 465-566) Resource Report Resource Website |
RRID:Addgene_89410 | CSPG5 | Mus musculus | Ampicillin | Backbone Marker:ATCC; Vector Backbone:pAS2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | aa 465-566 | 2026-07-25 12:53:34 | 0 | ||
|
pSG5-mCALEBlong (aa 1-566) Resource Report Resource Website |
RRID:Addgene_89399 | CSPG5 | Mus musculus | Ampicillin | Backbone Marker:Stratagene; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa 1-566 | 2026-07-25 12:53:33 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
