Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Gasdermin A
Vector Backbone Description: Vector Backbone:pZAG30; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_226234 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:9591; Vector Backbone:pHR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_216666 Copy
Species: Mus musculus
Genetic Insert: EEA1
Vector Backbone Description: Vector Backbone:pTwist Entr; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments: Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
Proper citation: RRID:Addgene_214991 Copy
Species: Mus musculus
Genetic Insert: anti-Neuroligin-2 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2916210. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_188184 Copy
Species: Mus musculus
Genetic Insert: CCGTATAGGCGGCTGCCCAA
Vector Backbone Description: Backbone Marker:NIDA GEVVC; Backbone Size:6400; Vector Backbone:pOTTC1553; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_195018 Copy
Species: Mus musculus
Genetic Insert: Tet1s
Vector Backbone Description: Backbone Size:6977; Vector Backbone:GFP Tet1 full-length (pc2271); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_201700 Copy
Species: Mus musculus
Genetic Insert: Tet1s
Vector Backbone Description: Backbone Size:9322; Vector Backbone:GFP-Uhrf1 (pc1756); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_201703 Copy
Species: Mus musculus
Genetic Insert: Tet1s-K852E
Vector Backbone Description: Backbone Size:9095; Vector Backbone:GFP-tagged construct encoding the catalitic domain of Tet1 (pc2315); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_201705 Copy
Species: Mus musculus
Genetic Insert: VprBP
Vector Backbone Description: Backbone Size:9322; Vector Backbone:mCherry Uhrf1 (pc1756); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_201699 Copy
Species: Mus musculus
Genetic Insert: anti-GFP (Aequorea victoria) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2941290. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206719 Copy
Species: Mus musculus
Genetic Insert: anti-Homer1L (Mus musculus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2941259. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206688 Copy
Species: Mus musculus
Genetic Insert: anti-AMIGO-1 (Mus musculus) recombinant Mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant antibody derived from RRID: AB_2941266. Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute
Proper citation: RRID:Addgene_206695 Copy
Species: Mus musculus
Genetic Insert: Cnr1
Vector Backbone Description: Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_209196 Copy
Species: Mus musculus
Genetic Insert: LdhA shRNA
Vector Backbone Description: Backbone Marker:Chen et al. 2014; Vector Backbone:LMPd Amt; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_209408 Copy
Species: Mus musculus
Genetic Insert: Phgdh shRNA
Vector Backbone Description: Backbone Marker:Chen et al. 2014; Vector Backbone:LMPd Amt; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_209409 Copy
Species: Mus musculus
Genetic Insert: anti-Neurabin-1/Ppp1r9a (Mus musculus) recombinant mouse monoclonal antibody.
Vector Backbone Description: Backbone Marker:Gavin Wright, Sanger; Yves Durocher, NRCC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a recombinant monoclonal antibody RRID: AB_3073576Isotype: IgG2a. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_211583 Copy
Species: Mus musculus
Genetic Insert: CSPG5
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:pAS2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_89408 Copy
Species: Mus musculus
Genetic Insert: CSPG5
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:pAS2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_89409 Copy
Species: Mus musculus
Genetic Insert: CSPG5
Vector Backbone Description: Backbone Marker:ATCC; Vector Backbone:pAS2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_89410 Copy
Species: Mus musculus
Genetic Insert: CSPG5
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_89399 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
