Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Icam 2 SaCas9 YAP sgRNA1 Resource Report Resource Website |
RRID:Addgene_99734 | SaCas9 gRNA targeting Yap1 | Mus musculus | Ampicillin | PMID:27926730 | Backbone Marker:Feng Zhang Lab; Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591); Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:19 | 0 | ||
|
AAV-KrasG13D/sgKras/Cre Resource Report Resource Website |
RRID:Addgene_99857 | Kras | Mus musculus | Ampicillin | PMID:29233960 | https://benchling.com/s/seq-J6bsGpWfPgLvKgL4LbPm | Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G13D mutation (GGC>GAC), Barcode = (AGGCAAGAGCGCCTTGACGATA>GGGTAAGTCAGCGCTGACAATA), BsiWI site (CGTGCG>CGTACG) | 2026-07-25 12:54:20 | 0 |
|
AAV-KrasG13S/sgKras/Cre Resource Report Resource Website |
RRID:Addgene_99859 | Kras | Mus musculus | Ampicillin | PMID:29233960 | https://benchling.com/s/seq-2y1YV8OIA9ubvJVqQRkH | Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G13S mutation (GGC>AGC), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGGAAATCTGCCCTGACCATA), BsiWI site (CGTGCG>CGTACG) | 2026-07-25 12:54:20 | 0 |
|
iMb-Notch-Mosaic (IR99.40) Resource Report Resource Website 1+ mentions |
RRID:Addgene_99749 | MbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST | Mus musculus | Ampicillin | PMID:28802047 | Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:20 | 2 | ||
|
pOC2 Tubb3 no donor Resource Report Resource Website |
RRID:Addgene_183431 | gRNA | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:23 | 0 | |
|
pOC2 Dlg4-Halo-FKBP KI Resource Report Resource Website |
RRID:Addgene_183435 | gRNA and Halo-FKBP donor | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pOC2; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:23 | 0 | |
|
pLeGO.sgGata1.4.RUNX1A.iG2 Resource Report Resource Website |
RRID:Addgene_181976 | GATA1 gRNA: CCTAGACCAGGAAAATCCAT | Mus musculus | Ampicillin | PMID:36493345 | Vector Backbone:pLeGO.iG2 ; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:22 | 0 | ||
|
pQCXIP-EGFP-CDMPR Resource Report Resource Website |
RRID:Addgene_182642 | CDMPR | Mus musculus | Ampicillin | PMID:35314489 | Backbone Marker:Clontech/Takara Bio; Backbone Size:7181; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:22 | 0 | ||
|
pOC3 smFP-HA-Cacna1e KI Resource Report Resource Website |
RRID:Addgene_183436 | gRNA and smFP HA donor | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pOC3; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:23 | 0 | |
|
pORANGE Tubb3-2xGFP KI Resource Report Resource Website 1+ mentions |
RRID:Addgene_183443 | gRNA and 2xGFP donor | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pORANGE; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:23 | 1 | |
|
pOC5 Tubb3-GFP KI Resource Report Resource Website |
RRID:Addgene_183440 | gRNA and GFP donor | Mus musculus | Ampicillin | PMID:35851300 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474730v1 for bioRxiv preprint. | Vector Backbone:pOC5; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:23 | 0 | |
|
pAD-CMV-STAT5A-CMV-GFP Resource Report Resource Website |
RRID:Addgene_83251 | Stat5a | Mus musculus | Ampicillin | PMID:27131881 | Backbone Marker:Invitrogen; Vector Backbone:pAD/CMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:23 | 0 | ||
|
Stargazin-mCherry-FRB Resource Report Resource Website |
RRID:Addgene_172443 | Cacng2 | Mus musculus | Kanamycin | PMID:35486148 | Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2021.04.23.441091v3. | Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:54:23 | 0 | |
|
px335 Slc1a3 nickase 2 Resource Report Resource Website |
RRID:Addgene_129411 | sgRNA targeting Slc1a3 | Mus musculus | Ampicillin | PMID:33686166 | Vector Backbone:pX335; Vector Types:Mammalian Expression, Mouse Targeting, CRISPR; Bacterial Resistance:Ampicillin | 2026-07-25 12:54:24 | 0 | ||
|
pD454-SR mouse Alpha-synuclein Resource Report Resource Website 1+ mentions |
RRID:Addgene_89075 | Alpha-synuclein | Mus musculus | Ampicillin | Backbone Marker:ATUM; Backbone Size:4037; Vector Backbone:pD454-SR; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:53:31 | 3 | |||
|
Gal4 PGC1 alpha 1-350 Resource Report Resource Website |
RRID:Addgene_8893 | PGC-1 alpha | Mus musculus | Ampicillin | PMID:10558993 | PGC1(1-350) was cloned downstream of the Gal4 DNA binding domain. | Backbone Size:4500; Vector Backbone:pCMX Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | amino acids 1-350 of PGC-1 alpha | 2026-07-25 12:53:30 | 0 |
|
Gal4 PGC1 alpha L2/3A Resource Report Resource Website |
RRID:Addgene_8898 | PGC-1a | Mus musculus | Ampicillin | PMID:14744933 | Backbone Size:4500; Vector Backbone:pCMX Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | LXXLL at aa140 is changed to AXXLL; LLXXL at aa 208 is changed to AAXXL. | 2026-07-25 12:53:30 | 0 | |
|
pcDNA flag PPAR gamma Resource Report Resource Website 10+ mentions |
RRID:Addgene_8895 | PPAR gamma | Mus musculus | Ampicillin | PMID:10748014 | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1 myc-His A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:53:30 | 29 | ||
|
pBJ 2358 Resource Report Resource Website |
RRID:Addgene_89245 | Capza1 | Mus musculus | Kanamycin | PMID:26412145 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP C-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:53:32 | 0 | ||
|
E1b-GFP-Tol2-Gateway mmu SE-Irf2bpl K Resource Report Resource Website |
RRID:Addgene_89380 | Irf2bpl | Mus musculus | Chloramphenicol and Ampicillin | PMID:27965291 | Backbone Marker:Nadav Ahituv lab; Vector Backbone:E1b-GFP-Tol2-Gateway; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-07-25 12:53:33 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
