Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
TRX1 His C32S C35S Resource Report Resource Website 1+ mentions |
RRID:Addgene_21286 | TRX1 | Homo sapiens | Ampicillin | PMID:12089063 | Backbone Size:5400; Vector Backbone:pcDNA3-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C32S C35S | 2026-07-25 12:44:24 | 2 | |
|
TRX1 flag C35S Resource Report Resource Website 1+ mentions |
RRID:Addgene_21285 | TRX1 | Homo sapiens | Ampicillin | PMID:12089063 | Backbone Size:5400; Vector Backbone:pcDNA3-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C35S | 2026-07-25 12:44:24 | 4 | |
|
TRX1 flag C32S Resource Report Resource Website 1+ mentions |
RRID:Addgene_21284 | TRX1 | Homo sapiens | Ampicillin | PMID:12089063 | Backbone Size:5400; Vector Backbone:pcDNA3-FLAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | C32S | 2026-07-25 12:44:24 | 3 | |
|
M-PKD2 (OF2-3) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21370 | autosomal dominant polycystic kidney disease type II | Homo sapiens | Ampicillin | PMID:11140688 | *Note that this construct has a rare SNP (rs1131408) at position 4:88967820 that results in a missense change (G449V). The polymorphism is not known to affect function. | Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wild-type* | 2026-07-25 12:44:25 | 4 |
|
pGL3-VEGFR2-225 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21306 | VEGFR2 promoter | Homo sapiens | Ampicillin | PMID:19242469 | -225 to +268 region of the promoter. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:24 | 1 | |
|
pGL3-VEGFR2-570 Resource Report Resource Website |
RRID:Addgene_21309 | VEGFR2 promoter | Homo sapiens | Ampicillin | PMID:19242469 | -570 to +268 region of the promoter. | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:24 | 0 | |
|
CFP-C1-PLCdelta-PH Resource Report Resource Website 1+ mentions |
RRID:Addgene_21262 | PLCdelta | Homo sapiens | Kanamycin | PMID:11134066 | Backbone Marker:Clontech; Backbone Size:4701; Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | PH domain of PLCdelta (human). Also known as PLCdelta-PH-CFP. Lab plasmid WC0026. | 2026-07-25 12:44:24 | 4 | |
|
pGL3b(1454/3172)P2P-wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_21404 | EGLN1 | Homo sapiens | Ampicillin | PMID:15563275 | Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:25 | 1 | ||
|
pEGFP-N1-FIH1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21403 | HIF1AN | Homo sapiens | Kanamycin | PMID:12615973 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:44:25 | 2 | ||
|
WT (REP10) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21368 | autosomal dominant polycystic kidney disease type I | Homo sapiens | Ampicillin | PMID:12482949 | Please note that Addgene NGS observed a S999P mutation in the PKD1 ORF. The effect of this mutation in unknown. | Backbone Marker:Invitrogen; Backbone Size:8500; Vector Backbone:pREP10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:25 | 1 | |
|
GFP-WT (AF41) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21367 | autosomal dominant polycystic kidney disease type I | Homo sapiens | Ampicillin | PMID:12482949 | *Please note: during Addgene's quality control process, the following mutations were found in PKD1: A691P, M792L, S999P, N1056T, T1724A, M1976V. The depositor has noted that the plasmid appears to be functional using several assays but it is not the standard PKD1 sequence in the database (Genbank ID L33243). | Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wild-type sequence* | 2026-07-25 12:44:25 | 1 |
|
E3020X Resource Report Resource Website |
RRID:Addgene_21366 | autosomal dominant polycystic kidney disease type I | Homo sapiens | Ampicillin | PMID:12482949 | Backbone Marker:Promega; Backbone Size:4713; Vector Backbone:pCI (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Changed E3020 to stop codon | 2026-07-25 12:44:25 | 0 | |
|
pLKO.1 shMTH1-2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21298 | shMTH1-2 | Homo sapiens | Ampicillin | PMID:19118192 | shRNA #2 directed against MTH1 sequence 5-GAAATTCCACGGGTACTTCAA-3′. | Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:24 | 2 | |
|
pLKO.1 shMTH1-1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21297 | shMTH1-1 | Homo sapiens | Ampicillin | PMID:19118192 | shRNA #1 directed against MTH1 sequence 5′-GTGGCTGCTGAACAGCTGCAA-3′. | Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:24 | 2 | |
|
pLKO human shRNA 2 DEPTOR Resource Report Resource Website |
RRID:Addgene_21336 | DEPTOR shRNA 2 | Homo sapiens | Ampicillin | PMID:19446321 | human DEPTOR shRNA 2 TRC candidate; NM_022783.1-1101s1c1 shRNA oligo sequence - 5'-CCGGGCAAGGAAGACATTCACGATTCTCGAGAATCGTGAATGTCTTCCTTGCTTTTTG | Backbone Marker:Available from Addgene; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:25 | 0 | |
|
pLKO human shRNA 1 DEPTOR Resource Report Resource Website 1+ mentions |
RRID:Addgene_21335 | DEPTOR shRNA 1 | Homo sapiens | Ampicillin | PMID:19446321 | human DEPTOR shRNA 1 TRC candidate; NM_022783.1-877s1c1 shRNA oligo sequence - 5'-CCGGGCCATGACAATCGGAAATCTACTCGAGTAGATTTCCGATTGTCATGGCTTTTTG | Backbone Marker:Available from Addgene (#10878); Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:25 | 1 | |
|
pBabe puro MTH1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21295 | MTH1 | Homo sapiens | Ampicillin | PMID:19118192 | The pBabe.puro MTH1 overexpression construct was created by amplifying the MTH1 cDNA from pcDEB.MTH1 (which expresses full-length wild type human MTH1) using PCR primers to add BamHI and EcoRI cloning sites to the 5' and 3' ends respectively, and ligating the resulting fragment into the appropriately digested retroviral pBABE puro vector. | Backbone Marker:Available at Addgene (#1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:24 | 1 | |
|
pCDNA3-T7-Keap1 Resource Report Resource Website |
RRID:Addgene_21552 | kelch-like ECH-associated protein 1 | Homo sapiens | Ampicillin | PMID:15601839 | Backbone Marker:Invitrogen; Backbone Size:5407; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:26 | 0 | ||
|
pTOPO-MCL1S159A Resource Report Resource Website 1+ mentions |
RRID:Addgene_21606 | MCL-1 S159A | Homo sapiens | Ampicillin | PMID:16543145 | Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1 /V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Serine 159 mutated to Alanine, abolishing phosphorylation by GSK-3. Insert ends with a STOP codon, no V5-His-tag. | 2026-07-25 12:44:26 | 2 | |
|
NHA-Ago4 Resource Report Resource Website |
RRID:Addgene_21537 | Ago4 | Homo sapiens | Ampicillin | PMID:19324964 | Backbone Size:5500; Vector Backbone:pCl-neo_NHA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:44:26 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
