Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Mdk shRNA
Vector Backbone Description: Backbone Marker:MIT; Backbone Size:7649; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid was generated as part of the NIAAA-funded INIA consortium.
Proper citation: RRID:Addgene_99025 Copy
Species: Mus musculus
Genetic Insert: Signal transducer and activator of transcription 3 - Y705F
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
References:
Comments: *E16K mutation in STAT3
Proper citation: RRID:Addgene_99261 Copy
Species: Mus musculus
Genetic Insert: Signal transducer and activator of transcription 3
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
References:
Comments: *E16K mutation in STAT3
Proper citation: RRID:Addgene_99260 Copy
Species: Mus musculus
Genetic Insert: Signal transducer and activator of transcription 3 - S727D
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:34621; Vector Backbone:pAdCMV/V5-DEST; Vector Types:Adenoviral; Bacterial Resistance:Ampicillin
References:
Comments: *E16K mutation in STAT3
Proper citation: RRID:Addgene_99263 Copy
Species: Mus musculus
Genetic Insert: CBP ZZ domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5443; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99334 Copy
Species: Mus musculus
Genetic Insert: mouse CBP BRD-ZZ domains (1079-1751)
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99341 Copy
Species: Mus musculus
Genetic Insert: mouse CBP BRD-ZZ domains (1079-1751) DeltaAL
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5493; Vector Backbone:pET22b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99551 Copy
Species: Mus musculus
Genetic Insert: Pak3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV- myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99510 Copy
Species: Mus musculus
Genetic Insert: mouse CBP BRD (1079-1198)
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:4970; Vector Backbone:pGEX4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99507 Copy
Species: Mus musculus
Genetic Insert: CREB3L3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5502; Vector Backbone:pcDNA3.1 V5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99509 Copy
Species: Mus musculus
Genetic Insert: dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG)
Vector Backbone Description: Vector Backbone:pAAV (pUC f1); Vector Types:AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
Proper citation: RRID:Addgene_99695 Copy
Species: Mus musculus
Genetic Insert: Gt(Rosa)26Sor
Vector Backbone Description: Vector Backbone:pBlueScript KS II; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99627 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: https://benchling.com/s/seq-GnrunufwzMMMiUzJgwLR
Proper citation: RRID:Addgene_99848 Copy
Species: Mus musculus
Genetic Insert: Tmeff2
Vector Backbone Description: Vector Backbone:pCDH-CMV-MCS-EF1-nlsCopGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99729 Copy
Species: Mus musculus
Genetic Insert: HIs-H2B-Cherry, H2B-EGFP-V5, HA-H2B-Cerulean, DN-Maml1, NICD-PEST
Vector Backbone Description: Vector Backbone:pBlueScript KS; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Please note that several discrepancies were found between Addgene's quality control and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_99752 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: https://benchling.com/s/seq-Fo9yObwqPPQCG479P7Ll
Proper citation: RRID:Addgene_99850 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: https://benchling.com/s/seq-ZwWNXX7tP0bisKZNlE3U
Proper citation: RRID:Addgene_99852 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: https://benchling.com/s/seq-VYuSAajucKlD3iRxltcy
Proper citation: RRID:Addgene_99854 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5958; Vector Backbone:388-MCS AAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: https://benchling.com/s/seq-atBNRmhI5tEHkQKLBbHp
Proper citation: RRID:Addgene_99853 Copy
Species: Mus musculus
Genetic Insert: SaCas9 gRNA targeting Yap1
Vector Backbone Description: Backbone Marker:Feng Zhang Lab; Vector Backbone:pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591); Vector Types:Mammalian Expression, AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_99735 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
