Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,374 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCAG-hHDAC4
 
Resource Report
Resource Website 		RRID:Addgene_21096 Histone Deacetylase 4 Homo sapiens Ampicillin PMID:19131628 WILD TYPE HDAC4 PROTEIN WITH DEGENERATE CODONS SCIENCE. 2009 JAN 09; 323 (5911):256-9. Backbone Marker:Cepko lab; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin shRNA target sequence was mutated (mutated nucleotides in small letters) to GGAaATGCTaGCtATGAAaCA using degenerate codons 2026-07-25 12:44:23 0
VP16-PBX2-pSV40
 
Resource Report
Resource Website 		RRID:Addgene_21095 PBX2 Homo sapiens Ampicillin Backbone Marker:Clontech; Backbone Size:3300; Vector Backbone:pVP16; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 0
PBX1A-pCMV1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21029 PBX1 Homo sapiens Ampicillin Backbone Size:4000; Vector Backbone:pCMV1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:22 2
pcDNA3-miR21
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21114 miR-21 Homo sapiens Ampicillin PMID:19359480 Backbone Size:5428; Vector Backbone:pcDNA3.1(+) (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 8
pcDNA3-miR17
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21113 miR-17 Homo sapiens Ampicillin PMID:19359480 Backbone Size:5428; Vector Backbone:pcDNA3.1(+) (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 1
HOXC8-pSG5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21001 HOXC8 Homo sapiens Ampicillin PMID:8104467 Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin missing first 24 N-terminal amino acids of coding DNA 2026-07-25 12:44:22 1
pcDNA3-miR29b(m4)
 
Resource Report
Resource Website 		RRID:Addgene_21122 miR-29b-1 Homo sapiens Ampicillin PMID:17204650 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin G to C change at nucleotide 21 of the mature miR-29b sequence by site-directed mutagenesis 2026-07-25 12:44:23 0
pcDNA3-miR29b
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21121 miR-29b-1 Homo sapiens Ampicillin PMID:17204650 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 1
HOXB4-FLAG-WG-SP65
 
Resource Report
Resource Website 		RRID:Addgene_21087 HOXB4 Homo sapiens Ampicillin PMID:8600458 PBX interaction mutant Please note that though the author's map suggests the insert is FLAG-tagged, Addgene was unable to confirm the presence of the FLAG. Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP65; Vector Types:In vitro T/T; Bacterial Resistance:Ampicillin W to G mutation in YPWM Pbx1 interaction motif, protein does not bind Pbx1 2026-07-25 12:44:23 0
pEGFP C3-YAP-deltaC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21126 Yes-kinase associated protein Homo sapiens Kanamycin PMID:19371381 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin 5 Carboxy-terminal amino acids -FLTWL are deleted 2026-07-25 12:44:23 2
pcDNA4/HisMaxB-YAP2-deltaC
 
Resource Report
Resource Website 		RRID:Addgene_21124 Yes-kinase associated protein Homo sapiens Ampicillin PMID:19371381 Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA4/HisMaxB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 5 Carboxy-terminal amino acids -FLTWL are deleted 2026-07-25 12:44:23 0
pESC-LEU-GFP-VHL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21053 von Hippel-Lindau tumor suppressor Homo sapiens Ampicillin PMID:18756251 Backbone Marker:Stratagene; Backbone Size:7800; Vector Backbone:pESC-LEU; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin 2026-07-25 12:44:22 2
pcDNA3.1/V5-His-TOPO-mir17-92
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21109 miR-17-92 cluster Homo sapiens Ampicillin PMID:15944709 Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 5
PBS/pU6- HIF1 alpha RNAi plasmid 1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21103 RNAi against hypoxia inducible factor 1alpha Homo sapiens Ampicillin PMID:19131628 HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA Backbone Size:3300; Vector Backbone:PBS/U6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 11
pcDNA3-HA-Sumo1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_21154 pcDNA3-HA-Sumo1 Homo sapiens Ampicillin PMID:15117942 This plasmid does not contain the BGH polyA terminator present in the standard pcDNA3 backbone. It is not known whether the removal of the terminator affects expression. Vector Backbone:pcDNA3.1 HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 15
pcDNA3-Beclin1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21150 PcDNA3-Beclin1 Homo sapiens Ampicillin PMID:16522639 Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 9
W1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21208 Mek1 Homo sapiens Kanamycin PMID:15342384 Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin 2026-07-25 12:44:23 2
CC2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21207 Mek1 Homo sapiens Kanamycin PMID:15342384 Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51. Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin Mek1 R4F fused to ER*, constitutive active 2026-07-25 12:44:23 3
L1
 
Resource Report
Resource Website 		RRID:Addgene_21200 Mek2 Homo sapiens Ampicillin PMID:15342384 Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin Mek2 K101A fused to ER*, catalytically inactive 2026-07-25 12:44:23 0
pGL3-Control-miR-17-5p-Sensor
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21166 miR-17-5p Control Homo sapiens Ampicillin PMID:15944709 Backbone Marker:Promega; Backbone Size:5523; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:44:23 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch