Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Histone Deacetylase 4
Vector Backbone Description: Backbone Marker:Cepko lab; Backbone Size:4798; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: WILD TYPE HDAC4
PROTEIN WITH DEGENERATE CODONS
SCIENCE. 2009 JAN 09; 323 (5911):256-9.
Proper citation: RRID:Addgene_21096 Copy
Species: Homo sapiens
Genetic Insert: PBX2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3300; Vector Backbone:pVP16; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21095 Copy
Species: Homo sapiens
Genetic Insert: PBX1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCMV1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21029 Copy
Species: Homo sapiens
Genetic Insert: miR-21
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1(+) (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21114 Copy
Species: Homo sapiens
Genetic Insert: miR-17
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1(+) (Invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21113 Copy
Species: Homo sapiens
Genetic Insert: HOXC8
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21001 Copy
Species: Homo sapiens
Genetic Insert: miR-29b-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21122 Copy
Species: Homo sapiens
Genetic Insert: miR-29b-1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21121 Copy
Species: Homo sapiens
Genetic Insert: HOXB4
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pSP65; Vector Types:In vitro T/T; Bacterial Resistance:Ampicillin
References:
Comments: PBX interaction mutant
Please note that though the author's map suggests the insert is FLAG-tagged, Addgene was unable to confirm the presence of the FLAG.
Proper citation: RRID:Addgene_21087 Copy
Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21126 Copy
Species: Homo sapiens
Genetic Insert: Yes-kinase associated protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5300; Vector Backbone:pcDNA4/HisMaxB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21124 Copy
Species: Homo sapiens
Genetic Insert: von Hippel-Lindau tumor suppressor
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:7800; Vector Backbone:pESC-LEU; Vector Types:Yeast Expression, yeast/bacteria shuttle; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21053 Copy
Species: Homo sapiens
Genetic Insert: miR-17-92 cluster
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5523; Vector Backbone:pcDNA3.1/V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21109 Copy
Species: Homo sapiens
Genetic Insert: RNAi against hypoxia inducible factor 1alpha
Vector Backbone Description: Backbone Size:3300; Vector Backbone:PBS/U6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: HIF1α RNAi target sequence: GAGCTTGCTCATCAGTTGCCA
Proper citation: RRID:Addgene_21103 Copy
Species: Homo sapiens
Genetic Insert: pcDNA3-HA-Sumo1
Vector Backbone Description: Vector Backbone:pcDNA3.1 HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid does not contain the BGH polyA terminator present in the standard pcDNA3 backbone. It is not known whether the removal of the terminator affects expression.
Proper citation: RRID:Addgene_21154 Copy
Species: Homo sapiens
Genetic Insert: PcDNA3-Beclin1
Vector Backbone Description: Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21150 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21208 Copy
Species: Homo sapiens
Genetic Insert: Mek1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2200; Vector Backbone:pENTR1A; Vector Types:Subclone vector; Bacterial Resistance:Kanamycin
References:
Comments: Constitutive active protein has the following aa sequence deleted - ALQKKLEELELDEQQRKRLE, residues 31 to 51.
Proper citation: RRID:Addgene_21207 Copy
Species: Homo sapiens
Genetic Insert: Mek2
Vector Backbone Description: Backbone Size:11100; Vector Backbone:LZRS-RfA; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21200 Copy
Species: Homo sapiens
Genetic Insert: miR-17-5p Control
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5523; Vector Backbone:pGL3-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21166 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
