Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: TPX2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_31227 Copy
Species: Homo sapiens
Genetic Insert: TPX2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pPAGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_31226 Copy
Species: Homo sapiens
Genetic Insert: HSF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31210 Copy
Species: Homo sapiens
Genetic Insert: MCM7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31212 Copy
Species: Homo sapiens
Genetic Insert: NCAPH
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31214 Copy
Species: Homo sapiens
Genetic Insert: diacylglycerol kinase, alpha
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31294 Copy
Species: Homo sapiens
Genetic Insert: RNF2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31216 Copy
Species: Homo sapiens
Genetic Insert: SPAG5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31217 Copy
Species: Homo sapiens
Genetic Insert: UCHL5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31219 Copy
Species: Homo sapiens
Genetic Insert: Bcr-abl fusion protein P190
Vector Backbone Description: Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This construct encodes a human chimeric P190-encoding Bcr/Abl oncogene.
The construct was made by Leena Haataja in 1993.
Proper citation: RRID:Addgene_31285 Copy
Species: Homo sapiens
Genetic Insert: K-Ras
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
References:
Comments: Do NOT use this plasmid directly for transfections, you will need to recombine it into a destination vector.
A set of 4 custom lentiviral vectors is available (http://www.addgene.org/25895, http://www.addgene.org/25896, http://www.addgene.org/25897, http://www.addgene.org/25890) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_31200 Copy
Species: Homo sapiens
Genetic Insert: ANLN
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti 6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Please note that the ANLN insert in this plasmid is based on GenBank entry BC034692, rather than the full-length transcript (GenBank entry NM_018685.2).
Proper citation: RRID:Addgene_31203 Copy
Species: Homo sapiens
Genetic Insert: ACP5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti 6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31204 Copy
Species: Homo sapiens
Genetic Insert: HMGB1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31208 Copy
Species: Homo sapiens
Genetic Insert: TopBP1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5-FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31313 Copy
Species: Homo sapiens
Genetic Insert: Mesothelin
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin
References:
Comments: Msln Promoter sequence provided by author (see above link)
Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid.
Msln-1F: TCATTTGTTCCCTTTGACGGC
Msln-1R: CTCTCCCCAGCATCCACATTC
Expect 987 nt product
Msln-2F: TTGCCTACAACACCCTGCTGCG
Msln-2R: GCTCACAATGCTTCCATCAAACG
Expect 792 nt product
Proper citation: RRID:Addgene_31305 Copy
Species: Homo sapiens
Genetic Insert: Human Homologue of Ariadne (HHARI)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Capili AD, Edghill EL, Wu, K and Borden KL (2004)Structure of the C-terminal RING Finger from a RING-IBR-RING/TRIAD Motif Reveals a Novel Zinc-binding Domain Distinct from a RING. J. Mol. Bio. 340:1117-29.
Proper citation: RRID:Addgene_31254 Copy
Species: Homo sapiens
Genetic Insert: Huntingtin-interacting protein 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31253 Copy
Species: Homo sapiens
Genetic Insert: cMyc
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_20076 Copy
Species: Homo sapiens
Genetic Insert: cMyc
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5111; Vector Backbone:pMSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Puro resistance cassette was removed by cutting pMSCVpuro with EcoRI and ClaI and religating. EcoRI site was maintained in the vector.
Proper citation: RRID:Addgene_20075 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
