Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CLN5
Vector Backbone Description: Backbone Size:4800; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37708259
Proper citation: RRID:Addgene_208891 Copy
Genetic Insert: Nb11-P2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET32a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40899502
Comments: Please visit https://doi.org/10.1101/2025.03.01.640988 for bioRxiv preprint.
Proper citation: RRID:Addgene_236499 Copy
Species: Synthetic
Genetic Insert: gaussia luciferase
Vector Backbone Description: Vector Backbone:pcDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36302988
Proper citation: RRID:Addgene_217491 Copy
Species: Synthetic
Genetic Insert: twinStrep_aMFx1
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781
Proper citation: RRID:Addgene_238906 Copy
Species: Synechocystis sp. PCC6803
Genetic Insert: SynPspA
Vector Backbone Description: Vector Backbone:pET50; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34166616
Proper citation: RRID:Addgene_223813 Copy
Species: Synechocystis sp. PCC6803
Genetic Insert: Vipp1
Vector Backbone Description: Vector Backbone:pET50; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39379528
Proper citation: RRID:Addgene_223816 Copy
Species: Synechocystis sp. PCC6803
Genetic Insert: Vipp1
Vector Backbone Description: Vector Backbone:pET50; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39379528
Proper citation: RRID:Addgene_223815 Copy
Species: Synthetic
Genetic Insert: twinStrep_FLAG_aMFx1
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781
Proper citation: RRID:Addgene_238904 Copy
Species: Synthetic
Genetic Insert: twinStrep_HA_aMFx1
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781
Comments: There are two twinStreps in this plasmid, and the depositor confirms that this does not affect function.
Proper citation: RRID:Addgene_238905 Copy
Species: Synthetic
Genetic Insert: C-term_aMFx1_noKREAEA
Vector Backbone Description: Backbone Marker:TWIST bioscience; Vector Backbone:High Copy Chloramphenicol; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:39674781
Proper citation: RRID:Addgene_238901 Copy
Species: Synthetic
Genetic Insert: sgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
Vector Backbone Description: Backbone Marker:Jamie Cate; Vector Backbone:pCAS (Addgene #60847); Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626221
Proper citation: RRID:Addgene_160297 Copy
Genetic Insert: NbALFA-mNeonGreen
Vector Backbone Description: Vector Backbone:pHAGE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_193974 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Synthetic, codon optimized for E. coli expression
Proper citation: RRID:Addgene_238370 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pMAL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Synthetic, codon optimized for E. coli expression
Proper citation: RRID:Addgene_238369 Copy
Species: Mus musculus
Genetic Insert: Pdzk3 (3/4)
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28031468
Comments: UniProt ID: Q99MJ6
Proper citation: RRID:Addgene_250130 Copy
Species: Burkholderia pseudomallei 1710b
Genetic Insert: 13467_[Himar]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_249826 Copy
Species: Burkholderia sp. 383
Genetic Insert: 13481_[Himar]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_249828 Copy
Species: Homo sapiens
Genetic Insert: ALDOC
Vector Backbone Description: Vector Backbone:pcDNA 3.3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41125938
Proper citation: RRID:Addgene_249426 Copy
Species: Burkholderia sp. 383
Genetic Insert: 13481_[abr]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_249822 Copy
Species: Bacillus anthracis
Genetic Insert: 14143_[abr]
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Proper citation: RRID:Addgene_249821 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.