Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 332 showing 6621 ~ 6640 out of 69,374 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_31822

    This resource has 1+ mentions.

http://www.addgene.org/31822

Species: Homo sapiens
Genetic Insert: NeuroD2
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:8851; Vector Backbone:N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31822 Copy   

    • RRID:Addgene_31814

    This resource has 1+ mentions.

http://www.addgene.org/31814

Species: Homo sapiens
Genetic Insert: FADD
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4000; Vector Backbone:pCI; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31814 Copy   

    • RRID:Addgene_31880

    This resource has 1+ mentions.

http://www.addgene.org/31880

Species: Homo sapiens
Genetic Insert: MEK1
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCS2CherDest; Vector Types:Expression Vector; Bacterial Resistance:Ampicillin
References:
Comments: Expression clone for generating mRNA encoding mcherry-actMEKK.

Proper citation: RRID:Addgene_31880 Copy   

    • RRID:Addgene_31994

http://www.addgene.org/31994

Species: Homo sapiens
Genetic Insert: CaM-RhoA(DP)
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx-3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31994 Copy   

    • RRID:Addgene_31877

    This resource has 1+ mentions.

http://www.addgene.org/31877

Species: Homo sapiens
Genetic Insert: myelin transcription factor 1-like
Vector Backbone Description: Backbone Marker:home made/Crabtree lab; Backbone Size:7998; Vector Backbone:pTight-N174; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31877 Copy   

    • RRID:Addgene_31879

    This resource has 1+ mentions.

http://www.addgene.org/31879

Species: Homo sapiens
Genetic Insert: human cytochrome C oxidase subunit VIII
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4646; Vector Backbone:N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_31879 Copy   

    • RRID:Addgene_31981

    This resource has 1+ mentions.

http://www.addgene.org/31981

Species: Homo sapiens
Genetic Insert: LOVS1K
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pTriEx 3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Cloning primers: 5' end: CATGCCATGGGGACTAGTTTGGCTACTACACTTGAACGTATTGA 3' end: CTAGCTAGCCAGTGAGTGGATGCCAGGGTTG LOVS1K should be co-expressed with Orai1, such as Orai1 CFP (http://www.addgene.org/19757) or Orai1 YFP (http://www.addgene.org/19756/) deposited by Anjana Rao.

Proper citation: RRID:Addgene_31981 Copy   

    • RRID:Addgene_31984

    This resource has 1+ mentions.

http://www.addgene.org/31984

Species: Homo sapiens
Genetic Insert: Cul5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5070; Vector Backbone:pcDNA5/FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31984 Copy   

    • RRID:Addgene_31986

    This resource has 10+ mentions.

http://www.addgene.org/31986

Species: Homo sapiens
Genetic Insert: ATM kd
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Do not send out as a spot on paper, send out in liquid form.

Proper citation: RRID:Addgene_31986 Copy   

    • RRID:Addgene_31985

    This resource has 10+ mentions.

http://www.addgene.org/31985

Species: Homo sapiens
Genetic Insert: ATM wild-type
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31985 Copy   

    • RRID:Addgene_31976

http://www.addgene.org/31976

Species: Homo sapiens
Genetic Insert: human STAG2 cDNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4727; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_31976 Copy   

http://www.addgene.org/31979

Species: Homo sapiens
Genetic Insert: STAG2
Vector Backbone Description: Vector Backbone:pLKO.1-Puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31979 Copy   

http://www.addgene.org/31978

Species: Homo sapiens
Genetic Insert: STAG2
Vector Backbone Description: Vector Backbone:pLKO.1-Puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31978 Copy   

    • RRID:Addgene_31961

    This resource has 10+ mentions.

http://www.addgene.org/31961

Species: Homo sapiens
Genetic Insert: ULK1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31961 Copy   

    • RRID:Addgene_31963

    This resource has 10+ mentions.

http://www.addgene.org/31963

Species: Homo sapiens
Genetic Insert: ULK1
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31963 Copy   

    • RRID:Addgene_31966

    This resource has 1+ mentions.

http://www.addgene.org/31966

Species: Homo sapiens
Genetic Insert: ULK2
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31966 Copy   

    • RRID:Addgene_31965

    This resource has 1+ mentions.

http://www.addgene.org/31965

Species: Homo sapiens
Genetic Insert: Atg13
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31965 Copy   

    • RRID:Addgene_31967

    This resource has 1+ mentions.

http://www.addgene.org/31967

Species: Homo sapiens
Genetic Insert: Atg13
Vector Backbone Description: Backbone Size:4754; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31967 Copy   

    • RRID:Addgene_31951

    This resource has 1+ mentions.

http://www.addgene.org/31951

Species: Homo sapiens
Genetic Insert: shRNA against hDna2
Vector Backbone Description: Backbone Size:7200; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31951 Copy   

    • RRID:Addgene_31952

    This resource has 1+ mentions.

http://www.addgene.org/31952

Species: Homo sapiens
Genetic Insert: shRNA against hDna2
Vector Backbone Description: Backbone Size:10000; Vector Backbone:pResQ; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_31952 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch