Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: *M93I and R185K mutations compared to NP_542409.1
Proper citation: RRID:Addgene_31416 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31418 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31417 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: *S171T mutation when compared to NP_003335.1
Proper citation: RRID:Addgene_31419 Copy
Species: Homo sapiens
Genetic Insert: YFP-HA-Protein Kinase D
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The HA tag on this plasmid contains a point mutation that renders it unrecognizable by the 3F10 HA antibody. It should work fine with the 12CA5 HA antibody.
Proper citation: RRID:Addgene_31527 Copy
Species: Homo sapiens
Genetic Insert: small fragment nuclease
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31593 Copy
Species: Homo sapiens
Genetic Insert: preimplantation protein 3
Vector Backbone Description: Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function.
Proper citation: RRID:Addgene_31592 Copy
Species: Homo sapiens
Genetic Insert: syntaxin 6
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31581 Copy
Species: Homo sapiens
Genetic Insert: growth arrest and DNA-damage-inducible, gamma
Vector Backbone Description: Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.
Proper citation: RRID:Addgene_31584 Copy
Species: Homo sapiens
Genetic Insert: coatomer protein complex, subunit epsilon
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31585 Copy
Species: Homo sapiens
Genetic Insert: RB shRNA
Vector Backbone Description: Backbone Size:13700; Vector Backbone:pSLIK-EGFP; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT
The shRNA is downstream of the EGFP
GGATAATCGTT
pSLIK vector from Ian Frasier
Proper citation: RRID:Addgene_31500 Copy
Species: Homo sapiens
Genetic Insert: Actin related protein 2/3 complex, subunit 3
Vector Backbone Description: Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.
Proper citation: RRID:Addgene_31580 Copy
Species: Homo sapiens
Genetic Insert: pirin
Vector Backbone Description: Backbone Size:3460; Vector Backbone:pQStrep2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function.
Proper citation: RRID:Addgene_31570 Copy
Species: Homo sapiens
Genetic Insert: HNF4A 3'UTR fragment
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: To measure regulatory potential of 3'UTR
Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid.
Proper citation: RRID:Addgene_31452 Copy
Species: Homo sapiens
Genetic Insert: HNF4A 3'UTR fragment
Vector Backbone Description: Backbone Size:6380; Vector Backbone:pRL-Con; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: To measure regulatory potential of 3'UTR
Proper citation: RRID:Addgene_31453 Copy
Species: Homo sapiens
Genetic Insert: phytanoyl-CoA hydroxylase interacting protein
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31578 Copy
Species: Homo sapiens
Genetic Insert: DiGeorge syndrome critical region gene 6
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31564 Copy
Species: Homo sapiens
Genetic Insert: transgelin 2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31569 Copy
Species: Homo sapiens
Genetic Insert: tumor protein, translationally-controlled 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.
Proper citation: RRID:Addgene_31558 Copy
Species: Homo sapiens
Genetic Insert: RB
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31496 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
