Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: Cdk1
Vector Backbone Description: Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: See attachment for description of backbone.
Proper citation: RRID:Addgene_27652 Copy
Species: Homo sapiens
Genetic Insert: Cdk1
Vector Backbone Description: Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: See attachment for description of backbone.
Proper citation: RRID:Addgene_27653 Copy
Species: Homo sapiens
Genetic Insert: Cdk2
Vector Backbone Description: Backbone Marker:M. Gossen et al., 1992 (PNAS); Backbone Size:3150; Vector Backbone:pUHD10-3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: See attachment for description of backbone.
Proper citation: RRID:Addgene_27651 Copy
Species: Homo sapiens
Genetic Insert: human ULK2 shRNA 91
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: human ULK2 shRNA 91 TRC candidate.
shRNA oligo sequence - 5'-CCGGGTCAGTGGTATTCGCATCAAACTCGAGTTTGATGCGAATACCACTGACTTTTT - 3'
Proper citation: RRID:Addgene_27634 Copy
Species: Homo sapiens
Genetic Insert: human ULK1 shRNA 8
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: human ULK1 shRNA 8 TRC candidate.
shRNA oligo sequence - 5'-CCGGACATCGAGAACGTCACCAAGTCTCGAGACTTGGTGACGTTCTCGATGTTTTTT - 3'
Proper citation: RRID:Addgene_27633 Copy
Species: Homo sapiens
Genetic Insert: Eps15
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_27696 Copy
Species: Homo sapiens
Genetic Insert: cavin-3
Vector Backbone Description: Backbone Marker:Helenius lab; Backbone Size:5502; Vector Backbone:pHA-N-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The mutation R8P is a known natural variant of cavin-3 (http://www.uniprot.org/uniprot/Q969G5) The cavin-3 cDNA used in this plasmid originated from the ORFeome library.
Proper citation: RRID:Addgene_27711 Copy
Species: Homo sapiens
Genetic Insert: Dynamin 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Cloned from IMAGE clone: 6473791 (MGC:57679).
Proper citation: RRID:Addgene_27689 Copy
Species: Homo sapiens
Genetic Insert: FBP17
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Cloned from cDNA library from human kidney.
This plasmid may be slow growing in bacteria. For difficult constructs you can use TG1s (they are Endonuclease positive, but good for cloning) and INV F' E.coli strains. The latter give the best results. Also when growing in culture try to switch to 2xTY media, which is richer that LB.
Proper citation: RRID:Addgene_27688 Copy
Species: Homo sapiens
Genetic Insert: Arp3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Cloned from IMAGE clone: 5261640 (MGC:57216).
Proper citation: RRID:Addgene_27682 Copy
Species: Homo sapiens
Genetic Insert: Ubiquitin Conjugating Enzyme
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31407 Copy
Species: Homo sapiens
Genetic Insert: Brd4FL
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31351 Copy
Species: Homo sapiens
Genetic Insert: Brd4 444-722
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31353 Copy
Species: Homo sapiens
Genetic Insert: Brd4 1224-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31355 Copy
Species: Homo sapiens
Genetic Insert: Brd4 1047-1362
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31354 Copy
Species: Homo sapiens
Genetic Insert: JMJD6
Vector Backbone Description: Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31358 Copy
Species: Homo sapiens
Genetic Insert: mitochondrial ribosomal protein S2 mature form
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31342 Copy
Species: Homo sapiens
Genetic Insert: mitochondrial ribosomal protein L15 mature form
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_31345 Copy
Species: Homo sapiens
Genetic Insert: protein phosphatase 1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31331 Copy
Species: Homo sapiens
Genetic Insert: PSMD10, proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (gankyrin)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence.
Proper citation: RRID:Addgene_31332 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
