Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
GFP-TREX1(D18N) Resource Report Resource Website 1+ mentions |
RRID:Addgene_27220 | TREX1 | Homo sapiens | Kanamycin | PMID:20871604 | Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | D18N sequence 52-GAC changed to AAC, resulting in Aspartic acid to Asparagine change. | 2026-07-25 12:45:16 | 7 | |
|
LRP6-pCS2-VSVG Resource Report Resource Website 1+ mentions |
RRID:Addgene_27282 | low density lipoprotein receptor-related protein 6 | Homo sapiens | Ampicillin | PMID:14731402 | Contains full-length human LRP6. Please note that the VSVG-tag was inserted after the LRP6 signal peptide at amino acid 25. | Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:xenopus injection; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:17 | 4 | |
|
Integrin alpha5-AHCys Resource Report Resource Website |
RRID:Addgene_27313 | integrin alpha 5 | Homo sapiens | Ampicillin | PMID:11323715 | There is a minor discrepancy between BLAST truncation position and depositor's truncation position. The discrepancies could be the secretion peptide that the depositing lab does not include in their numbering, or the C-terminal tags (that's about 40 aa.) | Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | integrin alpha5 (1-954) + AHCys | 2026-07-25 12:45:17 | 0 |
|
SEPT5 Mut(S327A) Resource Report Resource Website |
RRID:Addgene_27274 | Septin 5 | Homo sapiens | Ampicillin | PMID:18385322 | Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S327A | 2026-07-25 12:45:17 | 0 | |
|
SEPT5 Mut(S161A/S327A) Resource Report Resource Website |
RRID:Addgene_27275 | Septin 5 | Homo sapiens | Ampicillin | PMID:18385322 | Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S161A and S327A | 2026-07-25 12:45:17 | 0 | |
|
pEF1-alpha-V Resource Report Resource Website 1+ mentions |
RRID:Addgene_27290 | integrin alpha V | Homo sapiens | Ampicillin | PMID:12230977 | Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Isoform 2 | 2026-07-25 12:45:17 | 6 | |
|
pEF1-alpha-IIb Resource Report Resource Website 1+ mentions |
RRID:Addgene_27288 | integrin alpha IIb | Homo sapiens | Ampicillin | PMID:12230977 | Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | n/a | 2026-07-25 12:45:17 | 1 | |
|
LRP6-m5-pCS2-VSVG Resource Report Resource Website 1+ mentions |
RRID:Addgene_27283 | low density lipoprotein receptor-related protein 6 | Homo sapiens | Ampicillin | PMID:14731402 | Dominant inhibitor of Wnt function, similar to LRPT-dC | Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:xenopus injection; Bacterial Resistance:Ampicillin | Changed S/T of all five PPP(S/T)P motifs to Alanine. 2 of of the 5 sites deviate slightly from the consensus sequence (there is one PPAAP and one CPPAP) | 2026-07-25 12:45:17 | 2 |
|
p2Flag CMV2-ZO-2-delta-N Resource Report Resource Website |
RRID:Addgene_27419 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Size:4700; Vector Backbone:p2xFlag CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Deletion of coding nucleotides from 1-351. This results in N-terminal deletion of 117 amino acids. See Figure 3 in the paper for details. | 2026-07-25 12:45:18 | 0 | |
|
pCMV-Flag YAP127/128/131/381A Resource Report Resource Website 1+ mentions |
RRID:Addgene_27378 | YAP | Homo sapiens | Ampicillin | PMID:20048001 | Backbone Size:5000; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S127/128/131/381A | 2026-07-25 12:45:18 | 2 | |
|
pGEX-4T3-ZO-2-1st-PDZ-delta-NLS Resource Report Resource Website |
RRID:Addgene_27425 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Deletion of NLS-Nuclear Localization Signal: Nucleotides 313-873, counting A in the ATG start codon as 1, are deleted. | 2026-07-25 12:45:18 | 0 | |
|
pGEX-4T3-ZO-2-1st-PDZ Resource Report Resource Website |
RRID:Addgene_27424 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:18 | 0 | ||
|
pEGFP-C3-ZO-2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27422 | Zonula Occludens 2 | Homo sapiens | Kanamycin | PMID:20868367 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-07-25 12:45:18 | 3 | ||
|
p307HU Resource Report Resource Website 1+ mentions |
RRID:Addgene_27386 | unligated form of ligase ribozyme | Homo sapiens | Ampicillin | PMID:19965478 | Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A- binding loop. DNA representing the unligated form of this ribozyme was subcloned into pUC19 under a T7 transcription promoter, followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC AC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease. | Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:18 | 1 | |
|
pBABEpuro-Flag-ZO-2 Resource Report Resource Website |
RRID:Addgene_27420 | Zonula Occludens 2 | Homo sapiens | Ampicillin | PMID:20868367 | Backbone Marker:Addgene; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:18 | 0 | ||
|
pH307HP Resource Report Resource Website |
RRID:Addgene_27385 | post- ligation product of ligase ribozyme | Homo sapiens | Ampicillin | PMID:19965478 | pH307HP is used to transcribe RNA representing the post- ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG GACCCAC See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was digested with EarI nuclease. | Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:18 | 0 | |
|
plenti6.3/hCx43-stop Resource Report Resource Website 1+ mentions |
RRID:Addgene_27383 | Gja1 | Homo sapiens | Ampicillin | PMID:20038810 | Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:18 | 2 | ||
|
pCMV-flag S127A YAP Resource Report Resource Website 10+ mentions |
RRID:Addgene_27370 | YAP | Homo sapiens | Ampicillin | PMID:17974916 | Backbone Size:5000; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | S127A ( major phosphorylation site in YAP2) | 2026-07-25 12:45:17 | 31 | |
|
pLKO1-shYAP1 Resource Report Resource Website 10+ mentions |
RRID:Addgene_27368 | shYAP1 | Homo sapiens | Ampicillin | PMID:18579750 | YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC | Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:17 | 20 | |
|
pOZ-N-FH BRCC36 Resource Report Resource Website 1+ mentions |
RRID:Addgene_27496 | BRCC36 | Homo sapiens | Ampicillin | PMID:20656689 | Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-07-25 12:45:19 | 2 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
