Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: TREX1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_27220 Copy
Species: Homo sapiens
Genetic Insert: low density lipoprotein receptor-related protein 6
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:xenopus injection; Bacterial Resistance:Ampicillin
References:
Comments: Contains full-length human LRP6. Please note that the VSVG-tag was inserted after the LRP6 signal peptide at amino acid 25.
Proper citation: RRID:Addgene_27282 Copy
Species: Homo sapiens
Genetic Insert: integrin alpha 5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: There is a minor discrepancy between BLAST truncation position and depositor's truncation position. The discrepancies could be the secretion peptide that the depositing lab does not include in their numbering, or the C-terminal tags (that's about 40 aa.)
Proper citation: RRID:Addgene_27313 Copy
Species: Homo sapiens
Genetic Insert: Septin 5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27274 Copy
Species: Homo sapiens
Genetic Insert: Septin 5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3791; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27275 Copy
Species: Homo sapiens
Genetic Insert: integrin alpha V
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27290 Copy
Species: Homo sapiens
Genetic Insert: integrin alpha IIb
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6200; Vector Backbone:pEF1/V5-HisA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27288 Copy
Species: Homo sapiens
Genetic Insert: low density lipoprotein receptor-related protein 6
Vector Backbone Description: Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:xenopus injection; Bacterial Resistance:Ampicillin
References:
Comments: Dominant inhibitor of Wnt function, similar to LRPT-dC
Proper citation: RRID:Addgene_27283 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:p2xFlag CMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27419 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27378 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27425 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4969; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27424 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP C3; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_27422 Copy
Species: Homo sapiens
Genetic Insert: unligated form of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Improved class I ligase modified at the end of P5 with four additional base pairs terminating in the U1A-
binding loop. DNA representing the unligated form of this ribozyme was
subcloned into pUC19 under a T7 transcription promoter,
followed by a genomic hepatitis delta virus (HDV) self-cleaving ribozyme and an
EarI restriction site, yielding the plasmid p307HU. The HDV sequence cleaves itself from the ribozyme 3´ terminus, thereby producing a homogenous ribozyme 3´ end. The relevant sequence of the insert was
GCGTAATACGACTCACTATAGGAACACTATACTACTGGATAATCAAAGACAAATCTGCC
CGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCTCCGGT
GGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCCTCGCT
GGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACCC
AC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27386 Copy
Species: Homo sapiens
Genetic Insert: Zonula Occludens 2
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27420 Copy
Species: Homo sapiens
Genetic Insert: post- ligation product of ligase ribozyme
Vector Backbone Description: Backbone Size:0; Vector Backbone:pUC19 modified; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: pH307HP is used to transcribe RNA representing the post-
ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is
GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA
ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT
CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT
CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC
TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG
GACCCAC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
Proper citation: RRID:Addgene_27385 Copy
Species: Homo sapiens
Genetic Insert: Gja1
Vector Backbone Description: Backbone Size:9387; Vector Backbone:plenti6.3/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27383 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27370 Copy
Species: Homo sapiens
Genetic Insert: shYAP1
Vector Backbone Description: Backbone Size:8500; Vector Backbone:pLKO1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: YAP shRNA sequence is - 5'-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC
Proper citation: RRID:Addgene_27368 Copy
Species: Homo sapiens
Genetic Insert: BRCC36
Vector Backbone Description: Backbone Size:7900; Vector Backbone:pOZ-N; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_27496 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
