SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 31 showing 601 ~ 620 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_26876

    This resource has 1+ mentions.

http://www.addgene.org/26876

Genetic Insert: HTB tag
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pFA6ahphMX4; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16823883

Proper citation: RRID:Addgene_26876 Copy   


  • RRID:Addgene_26875

http://www.addgene.org/26875

Genetic Insert: HTB tag
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pFA6akanMX6; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16823883

Proper citation: RRID:Addgene_26875 Copy   


  • RRID:Addgene_26870

    This resource has 1+ mentions.

http://www.addgene.org/26870

Genetic Insert: CBFRE
Vector Backbone Description: Backbone Marker:Gaiano Lab; Backbone Size:0; Vector Backbone:CBFRE-EGFP; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17721509
Comments: CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of EGFP. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).

Proper citation: RRID:Addgene_26870 Copy   


  • RRID:Addgene_26872

http://www.addgene.org/26872

Genetic Insert: HBH tag
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pFA6akanMX6; Vector Types:PCR tagging yeast; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16823883

Proper citation: RRID:Addgene_26872 Copy   


  • RRID:Addgene_26966

    This resource has 50+ mentions.

http://www.addgene.org/26966

Species: Homo sapiens
Genetic Insert: eNpHR 3.0
Vector Backbone Description: Backbone Size:5609; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20303157
Comments: This plasmid contains the human elongation factor-1a promoter. Golgi export trafficking signal (TS) sequence is KSRITSEGEYIPLDQIDINV. ER export sequence is FCYENEV. For additional information please visit - http://www.optogenetics.org

Proper citation: RRID:Addgene_26966 Copy   


  • RRID:Addgene_26968

    This resource has 10+ mentions.

http://www.addgene.org/26968

Species: Homo sapiens
Genetic Insert: hChR2(E123T/H134R)-EYFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5587; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20081849
Comments: This plasmid contains the human elongation factor-1a promoter. For additional information please visit - http://www.optogenetics.org

Proper citation: RRID:Addgene_26968 Copy   


  • RRID:Addgene_26962

http://www.addgene.org/26962

Species: Saccharomyces cerevisiae
Genetic Insert: Sgf73(1-106)
Vector Backbone Description: Backbone Size:5900; Vector Backbone:PET32a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20395473

Proper citation: RRID:Addgene_26962 Copy   


  • RRID:Addgene_27018

http://www.addgene.org/27018

Genetic Insert: mir LEF1 1b
Vector Backbone Description: Backbone Size:6300; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19576624
Comments: shRNA sequence is 5'-GAGTTATTCCGGGTACATA

Proper citation: RRID:Addgene_27018 Copy   


  • RRID:Addgene_26961

    This resource has 1+ mentions.

http://www.addgene.org/26961

Species: Saccharomyces cerevisiae
Genetic Insert: Sus1
Vector Backbone Description: Backbone Size:3669; Vector Backbone:PRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20395473

Proper citation: RRID:Addgene_26961 Copy   


  • RRID:Addgene_27019

http://www.addgene.org/27019

Genetic Insert: mir LEF1 3a
Vector Backbone Description: Backbone Size:6300; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19576624
Comments: shRNA sequence is 5'-GTTGCTGAGTGTACTCTAA

Proper citation: RRID:Addgene_27019 Copy   


  • RRID:Addgene_26964

    This resource has 1+ mentions.

http://www.addgene.org/26964

Species: Saccharomyces cerevisiae
Genetic Insert: sgf11
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin and Streptomycin
Defining Citation: PMID:20395473
Comments: sgf 73(1-96) cloned in the second frame by NdeI+BglII for coexpression

Proper citation: RRID:Addgene_26964 Copy   


  • RRID:Addgene_27016

    This resource has 1+ mentions.

http://www.addgene.org/27016

Species: Homo sapiens
Genetic Insert: shRNA NEDD4L #1
Vector Backbone Description: Backbone Size:6401; Vector Backbone:pRetroSuper; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: shRNA sequence - 5'-gatccccGCTAGACTGTGGATTGAGTttcaagagaACTCAATCCACAGTCTAGCtttttggaaa

Proper citation: RRID:Addgene_27016 Copy   


  • RRID:Addgene_26960

http://www.addgene.org/26960

Species: Saccharomyces cerevisiae
Genetic Insert: sgf11
Vector Backbone Description: Backbone Marker:novagen; Backbone Size:3620; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:20395473

Proper citation: RRID:Addgene_26960 Copy   


  • RRID:Addgene_26977

    This resource has 1+ mentions.

http://www.addgene.org/26977

Species: Homo sapiens
Genetic Insert: TAp63gamma
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5597; Vector Backbone:pcDNA3.1 Hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17399686

Proper citation: RRID:Addgene_26977 Copy   


http://www.addgene.org/26976

Species: Homo sapiens
Genetic Insert: hChR2(H134R)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4568; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: This plasmid contains the human synapsin I promoter. For additional information please visit - http://www.optogenetics.org

Proper citation: RRID:Addgene_26976 Copy   


  • RRID:Addgene_26973

    This resource has 100+ mentions.

http://www.addgene.org/26973

Species: Homo sapiens
Genetic Insert: hChR2(H134R)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4574; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: This plasmid contains the human synapsin I promoter. For additional information please visit - http://www.optogenetics.org

Proper citation: RRID:Addgene_26973 Copy   


http://www.addgene.org/26975

Species: Homo sapiens
Genetic Insert: hChR2(H134R)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5386; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Comments: This plasmid contains the mouse calcium/calmodulin-dependent kinase II alpha subunit promoter. For additional information please visit - http://www.optogenetics.org

Proper citation: RRID:Addgene_26975 Copy   


http://www.addgene.org/27027

Species: Homo sapiens
Genetic Insert: Smad3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7800; Vector Backbone:pQCXIH; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: cDNA PCRed from pCS2-Flag Smad3 with 5' primer containing Flag tag.

Proper citation: RRID:Addgene_27027 Copy   


  • RRID:Addgene_27028

http://www.addgene.org/27028

Species: Homo sapiens
Genetic Insert: NEDD4L
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7200; Vector Backbone:pQCXIH; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19917253
Comments: Fragment from pCS2-HA NEDD4L, fill-in to make blunt-end insert.

Proper citation: RRID:Addgene_27028 Copy   


  • RRID:Addgene_27023

    This resource has 1+ mentions.

http://www.addgene.org/27023

Species: Homo sapiens
Genetic Insert: LEF1
Vector Backbone Description: Backbone Marker:Addgene Plasmid 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19576624

Proper citation: RRID:Addgene_27023 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X