Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: ERT2-Cre-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:4574; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149433 Copy
Species: Synthetic
Genetic Insert: Flp-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:4573; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149435 Copy
Species: Synthetic
Genetic Insert: ERT2-Cre-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Liqun Luo Lab (Addgene Plasmid #40026); Backbone Size:14483; Vector Backbone:pROSA26-TG; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936
Proper citation: RRID:Addgene_149436 Copy
Species: Homo sapiens
Genetic Insert: Fcgamma RIIa
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17110435
Comments: The FcgRIIa cDNA was amplified by RT-PCR using a Titan One Tube RT-PCR System kit (Roche, Mannheim, Germany) and a pair of primers (5'-TTGAATTCACCATGGAGACCCAAATGTCTC-3' and 5'-GCGGCCGCTTAGTTATTACTGTTGACATGG-3'). The PCR product was cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA) to generate pAC01 and subcloned as an EcoRI–NotI fragment into pIRESneo2 (Clontech, Mountain View, CA) to generate pCMV-FcgRIIa-IRES-Neo.
Proper citation: RRID:Addgene_14948 Copy
Species: hamster
Genetic Insert: HMG CoA synthase promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16141315
Comments: To generate pHMGCS-Luc, a PCR fragment containing nucleotides –379 to –17 of the hamster 3-hydroxy-3-methylglutaryl (HMG) CoA synthase gene was cloned into pGL2-basic.
PCR'd using primers: CGATCTCCTCTCACTGACCTTC and GCAGCTTTATAGCCACCGACCC.
Proper citation: RRID:Addgene_14947 Copy
Vector Backbone Description: Backbone Size:4493; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD95.77, Ligation number NONE.
Proper citation: RRID:Addgene_1495 Copy
Species: Homo sapiens
Genetic Insert: Rheb1
Vector Backbone Description: Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17386266
Proper citation: RRID:Addgene_14951 Copy
Species: Homo sapiens
Genetic Insert: rap2a
Vector Backbone Description: Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17386266
Proper citation: RRID:Addgene_14952 Copy
Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli
Proper citation: RRID:Addgene_149440 Copy
Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli
Proper citation: RRID:Addgene_149442 Copy
Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli
Proper citation: RRID:Addgene_149443 Copy
Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli
Proper citation: RRID:Addgene_149445 Copy
Species: Homo sapiens
Genetic Insert: Angiotensin-converting enzyme 2
Vector Backbone Description: Backbone Marker:Tropix, Bedford, MA; Backbone Size:7114; Vector Backbone:pSEAP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17079315
Comments: The vector includes 5' and 3' genomic regions of the human K18 gene, necessary for driving high-level epithelial-cell-specific expression
Proper citation: RRID:Addgene_149449 Copy
Species: Mus musculus
Genetic Insert: anti-GluK5/Grik5/KA2 kainate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750765. Isotype: IgG2a. Additional species: rat, mouse.
A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_149451 Copy
Species: Mus musculus
Genetic Insert: anti-Kirrel3, short isoform 3 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750773. Isotype: IgG2a. Additional species: mouse.
A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_149452 Copy
Species: Mus musculus
Genetic Insert: anti-BK beta4 K+ channel (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750681. Isotype: IgG2a. Additional species: human, mouse, rat.
A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_149454 Copy
Species: Mus musculus
Genetic Insert: anti-MMP9 matrix metalloproteinase-9 precursor (Rattus norvegicus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750689. Isotype: IgG2a. Additional species:human, mouse, rat.
A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_149455 Copy
Species: Mus musculus
Genetic Insert: anti-GABA(A)R, Alpha5 (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750794. Isotype: IgG2a. Additional species: humna, mouse, rat.
A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.
Proper citation: RRID:Addgene_149456 Copy
Species: Homo sapiens
Genetic Insert: RAP2
Vector Backbone Description: Backbone Size:7994; Vector Backbone:pCHA1.1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33208952
Proper citation: RRID:Addgene_149509 Copy
Species: Synthetic
Genetic Insert: AraC-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913
Proper citation: RRID:Addgene_149461 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.