Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 307 showing 6121 ~ 6140 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_149433

http://www.addgene.org/149433

Species: Synthetic
Genetic Insert: ERT2-Cre-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:4574; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936

Proper citation: RRID:Addgene_149433 Copy   


  • RRID:Addgene_149435

http://www.addgene.org/149435

Species: Synthetic
Genetic Insert: Flp-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Primo Schär Lab; Backbone Size:4573; Vector Backbone:pBigTB (Addgene Plasmid #149432); Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936

Proper citation: RRID:Addgene_149435 Copy   


  • RRID:Addgene_149436

    This resource has 1+ mentions.

http://www.addgene.org/149436

Species: Synthetic
Genetic Insert: ERT2-Cre-ERT2 fusion protein
Vector Backbone Description: Backbone Marker:Liqun Luo Lab (Addgene Plasmid #40026); Backbone Size:14483; Vector Backbone:pROSA26-TG; Vector Types:Mammalian Expression, Mouse Targeting, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33082936

Proper citation: RRID:Addgene_149436 Copy   


  • RRID:Addgene_14948

    This resource has 1+ mentions.

http://www.addgene.org/14948

Species: Homo sapiens
Genetic Insert: Fcgamma RIIa
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17110435
Comments: The FcgRIIa cDNA was amplified by RT-PCR using a Titan One Tube RT-PCR System kit (Roche, Mannheim, Germany) and a pair of primers (5'-TTGAATTCACCATGGAGACCCAAATGTCTC-3' and 5'-GCGGCCGCTTAGTTATTACTGTTGACATGG-3'). The PCR product was cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA) to generate pAC01 and subcloned as an EcoRI–NotI fragment into pIRESneo2 (Clontech, Mountain View, CA) to generate pCMV-FcgRIIa-IRES-Neo.

Proper citation: RRID:Addgene_14948 Copy   


http://www.addgene.org/14947

Species: hamster
Genetic Insert: HMG CoA synthase promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5597; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16141315
Comments: To generate pHMGCS-Luc, a PCR fragment containing nucleotides –379 to –17 of the hamster 3-hydroxy-3-methylglutaryl (HMG) CoA synthase gene was cloned into pGL2-basic. PCR'd using primers: CGATCTCCTCTCACTGACCTTC and GCAGCTTTATAGCCACCGACCC.

Proper citation: RRID:Addgene_14947 Copy   


  • RRID:Addgene_1495

    This resource has 10+ mentions.

http://www.addgene.org/1495

Vector Backbone Description: Backbone Size:4493; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD95.77, Ligation number NONE.

Proper citation: RRID:Addgene_1495 Copy   


  • RRID:Addgene_14951

    This resource has 1+ mentions.

http://www.addgene.org/14951

Species: Homo sapiens
Genetic Insert: Rheb1
Vector Backbone Description: Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17386266

Proper citation: RRID:Addgene_14951 Copy   


  • RRID:Addgene_14952

    This resource has 1+ mentions.

http://www.addgene.org/14952

Species: Homo sapiens
Genetic Insert: rap2a
Vector Backbone Description: Backbone Size:5300; Vector Backbone:HA-GST-pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17386266

Proper citation: RRID:Addgene_14952 Copy   


  • RRID:Addgene_149440

http://www.addgene.org/149440

Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli

Proper citation: RRID:Addgene_149440 Copy   


  • RRID:Addgene_149442

http://www.addgene.org/149442

Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli

Proper citation: RRID:Addgene_149442 Copy   


  • RRID:Addgene_149443

http://www.addgene.org/149443

Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli

Proper citation: RRID:Addgene_149443 Copy   


  • RRID:Addgene_149445

http://www.addgene.org/149445

Species: Homo sapiens
Genetic Insert: MIF
Vector Backbone Description: Vector Backbone:pET11b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For protein expression, use BL21-Gold (DE3) E. coli

Proper citation: RRID:Addgene_149445 Copy   


  • RRID:Addgene_149449

    This resource has 1+ mentions.

http://www.addgene.org/149449

Species: Homo sapiens
Genetic Insert: Angiotensin-converting enzyme 2
Vector Backbone Description: Backbone Marker:Tropix, Bedford, MA; Backbone Size:7114; Vector Backbone:pSEAP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17079315
Comments: The vector includes 5' and 3' genomic regions of the human K18 gene, necessary for driving high-level epithelial-cell-specific expression

Proper citation: RRID:Addgene_149449 Copy   


http://www.addgene.org/149451

Species: Mus musculus
Genetic Insert: anti-GluK5/Grik5/KA2 kainate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750765. Isotype: IgG2a. Additional species: rat, mouse. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_149451 Copy   


http://www.addgene.org/149452

Species: Mus musculus
Genetic Insert: anti-Kirrel3, short isoform 3 (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750773. Isotype: IgG2a. Additional species: mouse. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_149452 Copy   


http://www.addgene.org/149454

Species: Mus musculus
Genetic Insert: anti-BK beta4 K+ channel (Mus musculus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750681. Isotype: IgG2a. Additional species: human, mouse, rat. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_149454 Copy   


http://www.addgene.org/149455

Species: Mus musculus
Genetic Insert: anti-MMP9 matrix metalloproteinase-9 precursor (Rattus norvegicus) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750689. Isotype: IgG2a. Additional species:human, mouse, rat. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_149455 Copy   


http://www.addgene.org/149456

Species: Mus musculus
Genetic Insert: anti-GABA(A)R, Alpha5 (Homo sapiens) recombinant mouse monoclonal antibody
Vector Backbone Description: Backbone Marker:Yves Durocher, NRC; Backbone Size:5925; Vector Backbone:P1316-IgG2a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30667360
Comments: RRID: AB_2750794. Isotype: IgG2a. Additional species: humna, mouse, rat. A portion of this plasmid was derived from a plasmid, pTT3, which was obtained from Yves Durocher, National Research Council of Canada- Biotechnology Research Institute.

Proper citation: RRID:Addgene_149456 Copy   


  • RRID:Addgene_149509

http://www.addgene.org/149509

Species: Homo sapiens
Genetic Insert: RAP2
Vector Backbone Description: Backbone Size:7994; Vector Backbone:pCHA1.1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33208952

Proper citation: RRID:Addgene_149509 Copy   


  • RRID:Addgene_149461

http://www.addgene.org/149461

Species: Synthetic
Genetic Insert: AraC-mRFP
Vector Backbone Description: Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:34125913

Proper citation: RRID:Addgene_149461 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X