Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Plasmid library harboring a randomized 10nt PAM 5’ of target site 3
Vector Backbone Description: Vector Backbone:p11-LacY-wtx1 (Addgene plasmid #69056); Vector Types:CRISPR, Substrate for -Cas enzymes; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160134 Copy
Vector Backbone Description: Backbone Size:10615; Vector Backbone:LentiGuide backbone; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160090 Copy
Vector Backbone Description: Backbone Size:9363; Vector Backbone:pLX304 backbone; Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:32371478
Proper citation: RRID:Addgene_160092 Copy
Species: Homo sapiens
Genetic Insert: PAK5
Vector Backbone Description: Backbone Size:4900; Vector Backbone:pCMV6-myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12897128
Comments: Order of elements: SalI-Myc-XbaI-Pak5-EcoRI
Proper citation: RRID:Addgene_16020 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160136 Copy
Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160137 Copy
Species: Synthetic
Genetic Insert: AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443
Proper citation: RRID:Addgene_160138 Copy
Genetic Insert: Tet Operator (2x)
Vector Backbone Description: Backbone Size:7400; Vector Backbone:attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33963794
Proper citation: RRID:Addgene_160240 Copy
Species: Other
Genetic Insert: Cym Operator (2x)
Vector Backbone Description: Backbone Size:7400; Vector Backbone:attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33963794
Proper citation: RRID:Addgene_160242 Copy
Vector Backbone Description: Vector Backbone:pST50Trc; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32955754
Comments: Linearise vector with BamHI and HindIII, clone gene of interest in using COLI_Fwd and Tag_Rev primers using Gibson assembly, according to InteBac suite instructions.
Proper citation: RRID:Addgene_160243 Copy
Species: wheat
Genetic Insert: wheat GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875
Proper citation: RRID:Addgene_160392 Copy
Vector Backbone Description: Vector Backbone:pLIB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160272 Copy
Species: Vitis
Genetic Insert: Vitis miR396-resistant GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:2076; Vector Backbone:pDONR-zeo; Vector Types:Entry clon; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33046875
Proper citation: RRID:Addgene_160395 Copy
Vector Backbone Description: Vector Backbone:pLIB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160275 Copy
Genetic Insert: myrGFP
Vector Backbone Description: Backbone Size:5500; Vector Backbone:Gfa2-cLac; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This is a new version of Plasmid 22672: pGFAP::MyrGFP. A stop codon at the 3' end of myrEGFP prevents translation of the mouse Protamine 1 coding sequence downstream of the insert.
MyrEGFP fragment amplified by high fidelity PCR from plasmid pROSA26-mT-mG (www.addgene.org/17787) was InFusion cloned into BamHI site of pGFAP-EGFR* plasmid obtained from Dr. Eric Holland to construct this plasmid. The ~2.2 kb Gfa2 GFAP promoter in the pGFAP-EGFR* plasmid is presumably the same promoter utilized in the GFAP-tva transgenic mouse in Holland EC and Varmus HE https://doi.org/10.1073/pnas.95.3.1218. Addgene NGS sequencing of this plasmid confirmed the Gfa2 promoter sequence in this plasmid is identical to the hGFAP promoter sequences in other Gfa2 plasmids, such as hGFAP-GFP (http://www.addgene.org/40592/) and hGFAP-Cre (http://www.addgene.org/40591/).
Proper citation: RRID:Addgene_160277 Copy
Species: SARS-CoV-2
Genetic Insert: 3CL Protease
Vector Backbone Description: Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33910954
Comments: This plasmid is stored and distributed in NEB Stable. It can also be used to transform NEB 10Beta.
The authors have noticed that there are high rates of recombination in these generated vectors. All users are advised to sequence the vectors and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred it is typically between the viral LTR elements in the vector although recombination between the gateway cloning sites has also been observed.
Please visit https://doi.org/10.1101/2020.08.29.272864 for bioRxiv preprint.
Proper citation: RRID:Addgene_160278 Copy
Species: SARS-CoV-2
Genetic Insert: 3CL Protease
Vector Backbone Description: Vector Backbone:pLEX_307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33910954
Comments: This plasmid is stored and distributed in NEB Stable. It can also be used to transform NEB 10Beta.
The authors have noticed that there are high rates of recombination in these generated vectors. All users are advised to sequence the vectors and run them on a gel to ensure they show the expected full length insert and plasmid size. In cases where recombination has occurred it is typically between the viral LTR elements in the vector although recombination between the gateway cloning sites has also been observed.
Please visit https://doi.org/10.1101/2020.08.29.272864 for bioRxiv preprint.
Proper citation: RRID:Addgene_160279 Copy
Species: Homo sapiens
Genetic Insert: COL4A1
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32554938
Comments: Please note: Plasmid contains a T824P mutation in the insert (lies within the Mature Domain). This variant is not known to affect plasmid function.
Proper citation: RRID:Addgene_160317 Copy
Vector Backbone Description: Vector Backbone:pST50Trc; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160260 Copy
Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754
Proper citation: RRID:Addgene_160263 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
