Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: NFS1
Vector Backbone Description: Backbone Size:5578; Vector Backbone:pBabe hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Proper citation: RRID:Addgene_102977 Copy
Species: Homo sapiens
Genetic Insert: NFS1 C381A
Vector Backbone Description: Backbone Size:5578; Vector Backbone:pBabe hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Proper citation: RRID:Addgene_102978 Copy
Species: Homo sapiens
Genetic Insert: shFXN_2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000006137
Proper citation: RRID:Addgene_102971 Copy
Species: Homo sapiens
Genetic Insert: shISCU
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO_TRC005; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000289988
Proper citation: RRID:Addgene_102972 Copy
Species: Homo sapiens
Genetic Insert: shMOCS3_1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:7466; Vector Backbone:pLKO.1P; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29168506
Comments: TRCN0000045642
Proper citation: RRID:Addgene_102973 Copy
Species: Other
Genetic Insert: A5EIM8(Cas9 coding gene from Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103081 Copy
Species: Other
Genetic Insert: A8LN05(Cas9 coding gene from Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103083 Copy
Species: Other
Genetic Insert: A7HP89(Cas9 coding gene from Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103082 Copy
Species: Other
Genetic Insert: G9WGU4(Cas9 coding gene from Oenococcus kitaharae DSM 17330)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103112 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-127-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103194 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-1271-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:29934631
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103196 Copy
Species: Other
Genetic Insert: K0XCK7(Cas9 coding gene from Barnesiella intestinihominis YIT 11860)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103118 Copy
Species: Other
Genetic Insert: J6LE60(Cas9 coding gene from Rhodovulum sp. PH10)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103117 Copy
Species: Other
Genetic Insert: J5TNY4(Cas9 coding gene from Porphyromonas sp. oral taxon 279 str. F0450)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103116 Copy
Species: Other
Genetic Insert: C7TEQ6(Cas9 coding gene from Lactobacillus rhamnosus (strain ATCC 53103 / GG))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103092 Copy
Species: Other
Genetic Insert: C7G697(Cas9 coding gene from Roseburia intestinalis L1-82)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103091 Copy
Species: Other
Genetic Insert: D1VXP4(Cas9 coding gene from Prevotella timonensis CRIS 5C-B1)
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103093 Copy
Species: Other
Genetic Insert: C4ZA16(Cas9 coding gene from Eubacterium rectale (strain ATCC 33656 / VPI 0990))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103090 Copy
Species: Other
Genetic Insert: B8I085(Cas9 coding gene from Clostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103089 Copy
Species: Other
Genetic Insert: • Q1QGC9(Cas9 coding gene from Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9))
Vector Backbone Description: Backbone Marker:NEB(New England Biolabs); Vector Backbone:pUC19; Vector Types:CRISPR, Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29529247
Proper citation: RRID:Addgene_103121 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.