Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: TET1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3780; Vector Backbone:pCDF-Duet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:26932196
Proper citation: RRID:Addgene_81054 Copy
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89730 Copy
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89732 Copy
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89731 Copy
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89727 Copy
Genetic Insert: CRISPR array
Vector Backbone Description: Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27738137
Proper citation: RRID:Addgene_89729 Copy
Species: Homo sapiens
Genetic Insert: Replication factor C subunit 1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3559; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32907938
Proper citation: RRID:Addgene_175043 Copy
Species: Homo sapiens
Genetic Insert: SAE1
Vector Backbone Description: Backbone Marker:Novagen - lab stock; Backbone Size:3600; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34035521
Proper citation: RRID:Addgene_175241 Copy
Species: Pseudoalteromonas translucida
Genetic Insert: PtrTniQ, PtrCas5/8, PtrCas7, PtrCas6, CRISPR(BsaI)
Vector Backbone Description: Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34478496
Proper citation: RRID:Addgene_175579 Copy
Vector Backbone Description: Backbone Size:4553; Vector Backbone:pTC-mcs; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:21238944
Proper citation: RRID:Addgene_31288 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses rat APOBEC1. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth rApo1]
Proper citation: RRID:Addgene_156459 Copy
Species: Rattus norvegicus
Genetic Insert: rApoI
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29991261
Comments: Esherichia coli strain that expresses MutaT7, a fusion of rat APOBEC1 and the T7 RNA polymerase. Genotype: DH10B Δung ΔmotAB ΔcsgABCDEFG [PlacI<>Ptac] Δ(araA-leu)7697::[PA1lacO-Tenth MutaT7]
Proper citation: RRID:Addgene_156460 Copy
Genetic Insert: egfp
Vector Backbone Description: Backbone Marker:Schmidt-Dannert Lab; Backbone Size:2220; Vector Backbone:pCDFBB; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:22033566
Proper citation: RRID:Addgene_32550 Copy
Species: Mycobacterium tuberculosis
Genetic Insert: PanB
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pGMCS; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:20711362
Proper citation: RRID:Addgene_27127 Copy
Genetic Insert: n/a
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Comments: This strain has 572 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110017 and the accompanying paper for more details.
Proper citation: RRID:Addgene_201049 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092
Proper citation: RRID:Addgene_194154 Copy
Species: E. coli
Genetic Insert: transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry
Vector Backbone Description: Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34820092
Proper citation: RRID:Addgene_194155 Copy
Vector Backbone Description: Backbone Size:5261; Vector Backbone:CloDF13; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39126322
Proper citation: RRID:Addgene_213132 Copy
Species: Synthetic
Genetic Insert: T0 terminator - Sm resistance cassette
Vector Backbone Description: Backbone Size:4948; Vector Backbone:pSH624-ssr; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:37798358
Proper citation: RRID:Addgene_198026 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
