Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: HsNot1iso1-IKGRQtoDSYAA-shRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24768540
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147900 Copy
Species: Drosophila melanogaster
Genetic Insert: DmCaf40_25-291
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24768540
Comments: ORF extracted from NCBI: NM_167675.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147866 Copy
Species: Homo sapiens
Genetic Insert: HsNot9-Y203AR205AH208AR244A-shRNA1res
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24768540
Comments: sequence based on NCBI:NM_005444.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147907 Copy
Species: Homo sapiens
Genetic Insert: HsNot9-shRNAres2
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24768540
Comments: sequence based on NCBI:NM_005444.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147905 Copy
Species: Drosophila melanogaster
Genetic Insert: DmeIF4A-dsRNAres
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: Sequence extracted from NCBI:NM_164668.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148201 Copy
Vector Backbone Description: Backbone Size:3786; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: See Fire Lab Vector Kit Documentation 1995. Fire Lab Miniprep Number pPD95.02, Ligation number NONE.
Proper citation: RRID:Addgene_1478 Copy
Species: Drosophila melanogaster
Genetic Insert: DmRUMP-del233-341
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: ORF extracted from NCBI: NM_141642.1 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147920 Copy
Species: Homo sapiens
Genetic Insert: HsDCP1a-S12AQ18AH19A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24510189
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147805 Copy
Species: Drosophila melanogaster
Genetic Insert: Roc1b
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_14823 Copy
Species: Drosophila melanogaster
Genetic Insert: Roc2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_14824 Copy
Species: Homo sapiens
Genetic Insert: HsNot1iso1_1356-1581
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24768540
Comments: Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_147779 Copy
Species: Mus musculus
Genetic Insert: Hmga2 wt
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). The UTR fragment was then cloned back into the vector containing the Hmga2 cDNA (pCMV•SPORT6.1). To construct the mammalian expression vectors, Hmga2 inserts were excised from the pCMV•SPORT6.1 constructs using EcoRI restriction sites and cloned into pcDNA3.1 (Invitrogen).
Proper citation: RRID:Addgene_14789 Copy
Species: Drosophila melanogaster
Genetic Insert: PCNA-GFP
Vector Backbone Description: Backbone Marker:na; Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12526745
Comments: PCNA GFP fusion (glow); Asp718-NotI fragment from pRD113 cloned into pCasper4IN; GFP fused in-frame using 5' blunt NheI and 3' XbaI (replaces PCNA coding to STOP [XbaI] but has PCNA 3'; GFP from pNEGFPX.1.
Proper citation: RRID:Addgene_14822 Copy
Species: Drosophila melanogaster
Genetic Insert: E2F
Vector Backbone Description: Backbone Marker:na; Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Dros14 dE2F clone flipped at EcoRI site; XhoI digestion gives small fragment--i.e. 5' end near KpnI site; contains entire 3' UTR from Genebank sequence including polyA.
Proper citation: RRID:Addgene_14820 Copy
Species: Drosophila melanogaster
Genetic Insert: DmSKI8
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: sequence given by NCBI:NM_141712.3 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148227 Copy
Species: Mus musculus
Genetic Insert: let-7g
Vector Backbone Description: Backbone Marker:BD Biosciences; Backbone Size:6500; Vector Backbone:MSCV-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: miRNA of the following mature sequence, with approximately 500 basepairs of flanking sequence, were cloned into MSCV-neo: let-7g: 5’-UGAGG UAGUA GUUUG UACAG U-3’.
Proper citation: RRID:Addgene_14784 Copy
Species: Mus musculus
Genetic Insert: Luc-wt
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4000; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17322030
Comments: The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.
Proper citation: RRID:Addgene_14785 Copy
Species: Neurospora crassa
Genetic Insert: NcPAN2_1-390
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24880343
Comments: ORF extracted from N. crassa Databank NCU10733.7 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.
Proper citation: RRID:Addgene_148103 Copy
Species: Mus musculus
Genetic Insert: Drosha shRNA
Vector Backbone Description: Backbone Marker:OligoEngine; Backbone Size:6350; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: GATCCCCCAA CAGTCATAGA ATATGATTCA AGAGATCATA TTCTATGACT GTTGTTTTTG GAAC
Proper citation: RRID:Addgene_14780 Copy
Species: Mus musculus
Genetic Insert: Dicer shRNA
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17401365
Comments: shRNA sequence: TGCATGGTGG TGTCGATATT TTCAAGAGAA ATATCGACAC CACCATGCTT TTTTC
Proper citation: RRID:Addgene_14781 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
