Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

745,085 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGCGFP-hyg
 
Resource Report
Resource Website 		RRID:Addgene_31265 GCGFP Ampicillin Backbone Size:2316; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
pGCGFP-puro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31266 GCGFP Ampicillin Backbone Size:2316; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 1
pXRDRE-hyg
 
Resource Report
Resource Website 		RRID:Addgene_31269 XRDRE Ampicillin Backbone Size:1994; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
iXFGFR4k
 
Resource Report
Resource Website 		RRID:Addgene_31260 Xenopus FGFR4-ICD-FKBP Xenopus laevis Ampicillin PMID:20013652 Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
LCMV:ECFP(loxP)EYFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31306 ECFP(loxP)EYFP Ampicillin PMID:12682379 Cre reporter: from blue fluorescence to yellow fluorescence Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 1
pAdEasy-Msln-iCre-HA-Flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31305 Mesothelin Homo sapiens Kanamycin PMID:21505261 Msln Promoter sequence provided by author (see above link) Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid. Msln-1F: TCATTTGTTCCCTTTGACGGC Msln-1R: CTCTCCCCAGCATCCACATTC Expect 987 nt product Msln-2F: TTGCCTACAACACCCTGCTGCG Msln-2R: GCTCACAATGCTTCCATCAAACG Expect 792 nt product Backbone Marker:Stratagene; Backbone Size:33000; Vector Backbone:pAdEasy; Vector Types:Adenoviral; Bacterial Resistance:Kanamycin Addgene 2026-11-07 01:13:47 2
pCARCre
 
Resource Report
Resource Website 		RRID:Addgene_31309 cardiac actin / Cre Xenopus laevis Ampicillin PMID:12682379 pCARGFP (Kroll et al 1996) used to replace the GFP with Cre from pCSCre2 Backbone Size:3000; Vector Backbone:N/A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
pGEX-4T HHARI RBR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31254 Human Homologue of Ariadne (HHARI) Homo sapiens Ampicillin PMID:21532592 Capili AD, Edghill EL, Wu, K and Borden KL (2004)Structure of the C-terminal RING Finger from a RING-IBR-RING/TRIAD Motif Reveals a Novel Zinc-binding Domain Distinct from a RING. J. Mol. Bio. 340:1117-29. Backbone Size:5000; Vector Backbone:pGEX-4T2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin RBR domain residues 177-395 Addgene 2026-11-07 01:13:46 1
pcDNA3/HIP1/ΔLD
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31253 Huntingtin-interacting protein 1 Homo sapiens Ampicillin PMID:12163454 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Deltion of nucleotides 767-1335 Addgene 2026-11-07 01:13:46 1
pCKPC4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31366 Clock Mus musculus Ampicillin PMID:21613214 Backbone Size:5100; Vector Backbone:pcDNA4a; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:48 1
pC1BA
 
Resource Report
Resource Website 		RRID:Addgene_31368 Cry1 Mus musculus Ampicillin PMID:21613214 Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:48 0
pBMPC3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31367 Bmal1 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:48 8
pCHNFI-X2
 
Resource Report
Resource Website 		RRID:Addgene_31402 Nuclear Factor IX isoform 2 Mus musculus Ampicillin PMID:9660824 Backbone Marker:MacGregor and Caskey; Backbone Size:3771; Vector Backbone:pCMVbeta; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:48 0
Ube2g1
 
Resource Report
Resource Website 		RRID:Addgene_31407 Ubiquitin Conjugating Enzyme Homo sapiens Ampicillin PMID:17873885 Backbone Marker:Clonetech; Backbone Size:8100; Vector Backbone:pACT2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:48 0
p6344 pcDNA4-TO-HA-Brd4FL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31351 Brd4FL Homo sapiens Ampicillin PMID:21555454 Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA4/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 9
p6347 MSCV-CMV-Flag-HA-Brd4-444-722
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31353 Brd4 444-722 Homo sapiens Ampicillin PMID:21555454 Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 1
p6349 MSCV-CMV-Flag-HA-Brd4 1224-1362
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31355 Brd4 1224-1362 Homo sapiens Ampicillin PMID:21555454 Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 2
p6348 MSCV-CMV-Flag-HA-Brd4 1047-1362
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31354 Brd4 1047-1362 Homo sapiens Ampicillin PMID:21555454 Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 1
p6352 MSCV-CMV-CMV-Flag-HA-JMJD6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31358 JMJD6 Homo sapiens Ampicillin PMID:21555454 Backbone Size:5000; Vector Backbone:MSCV-CMV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:48 8
pET21-MRPS2
 
Resource Report
Resource Website 		RRID:Addgene_31342 mitochondrial ribosomal protein S2 mature form Homo sapiens Ampicillin PMID:18539099 Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Encodes the predicted mature form for incorporation into ribosomes, Amino acids 49-296 Addgene 2026-11-07 01:13:47 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch