Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 29 showing 561 ~ 580 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/22694

Species: Homo sapiens
Genetic Insert: miR-31
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Useful for stable suppression of miR-31 function. Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel Repeated sequence is: AGGCAAGACGAGGCATAGCT *Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.

Proper citation: RRID:Addgene_22694 Copy   


  • RRID:Addgene_22709

http://www.addgene.org/22709

Species: Drosophila melanogaster
Genetic Insert: micro-RNA-92b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17901217

Proper citation: RRID:Addgene_22709 Copy   


  • RRID:Addgene_22705

    This resource has 1+ mentions.

http://www.addgene.org/22705

Species: Homo sapiens
Genetic Insert: Egg laying Nine - 2 (EglN2)
Vector Backbone Description: Backbone Size:5145; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873

Proper citation: RRID:Addgene_22705 Copy   


  • RRID:Addgene_22668

http://www.addgene.org/22668

Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This plasmid is identical to Plasmid 22664: pId1-B.IRES-Venus.

Proper citation: RRID:Addgene_22668 Copy   


http://www.addgene.org/22789

Species: Drosophila melanogaster
Genetic Insert: micro RNA 6-1, micro RNA 6-2, micro RNA 6-3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16581772

Proper citation: RRID:Addgene_22789 Copy   


  • RRID:Addgene_22669

http://www.addgene.org/22669

Genetic Insert: NeoR
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442

Proper citation: RRID:Addgene_22669 Copy   


http://www.addgene.org/22703

Species: Homo sapiens
Genetic Insert: cyclin D1
Vector Backbone Description: Backbone Size:5536; Vector Backbone:pBabe-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19878873

Proper citation: RRID:Addgene_22703 Copy   


  • RRID:Addgene_22665

http://www.addgene.org/22665

Genetic Insert: IRES-Venus
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442

Proper citation: RRID:Addgene_22665 Copy   


  • RRID:Addgene_22786

http://www.addgene.org/22786

Genetic Insert: A DNA containing CHLI fragment
Vector Backbone Description: Backbone Size:5702; Vector Backbone:pBluescript SK+ II (original backbone); Vector Types:RNAi, Arabidopsis VIGS vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967097
Comments: Has a 360-bp CHLI insert as a visual marker for silencing cloned into A-DNA vector. magnesium chelatase subunit I. --Must be bombarded with appropriate B DNA for systemic infection

Proper citation: RRID:Addgene_22786 Copy   


  • RRID:Addgene_22787

http://www.addgene.org/22787

Genetic Insert: B DNA
Vector Backbone Description: Backbone Size:6854; Vector Backbone:pBluescript SK+ II (original backbone); Vector Types:RNAi, Arabidopsis VIGS vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967097

Proper citation: RRID:Addgene_22787 Copy   


  • RRID:Addgene_22667

    This resource has 1+ mentions.

http://www.addgene.org/22667

Species: Mus musculus
Genetic Insert: Inhibitor of DNA binding 1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442
Comments: This plasmid is identical to pId1-IRES-Venus (Plasmid #22663).

Proper citation: RRID:Addgene_22667 Copy   


  • RRID:Addgene_22781

    This resource has 1+ mentions.

http://www.addgene.org/22781

Species: Homo sapiens
Genetic Insert: PAK binding domain
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pYpet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013

Proper citation: RRID:Addgene_22781 Copy   


  • RRID:Addgene_22782

    This resource has 1+ mentions.

http://www.addgene.org/22782

Species: Homo sapiens
Genetic Insert: Rac1 (wt)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCyPet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013

Proper citation: RRID:Addgene_22782 Copy   


  • RRID:Addgene_22783

    This resource has 1+ mentions.

http://www.addgene.org/22783

Species: Homo sapiens
Genetic Insert: Rac1 (Q61L)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCyPet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013

Proper citation: RRID:Addgene_22783 Copy   


  • RRID:Addgene_22784

    This resource has 1+ mentions.

http://www.addgene.org/22784

Species: Homo sapiens
Genetic Insert: Rac1 (T17N)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCyPet-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013

Proper citation: RRID:Addgene_22784 Copy   


  • RRID:Addgene_22780

    This resource has 1+ mentions.

http://www.addgene.org/22780

Species: A. victoria
Genetic Insert: Ypet
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pYpet-C1-Control; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19693013

Proper citation: RRID:Addgene_22780 Copy   


  • RRID:Addgene_22713

    This resource has 1+ mentions.

http://www.addgene.org/22713

Species: Mus musculus
Genetic Insert: Myelin Transcription Factor 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3948; Vector Backbone:pCRII; Vector Types:cloning vector TT/AA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9373037
Comments: The murine Myt1 cDNA (6 zinc fingers) had 3 base mutations within the coding region (bp 806, 837 and 4344). These sites were corrected using Stratagene QuickChang Site-Directed mutagenesis. The Myt1 was sequenced after the mutagenesis and found to be correct. There is still one mutation in the 5' UTR at bp 529 (START codon is bp 532)

Proper citation: RRID:Addgene_22713 Copy   


  • RRID:Addgene_22677

    This resource has 1+ mentions.

http://www.addgene.org/22677

Genetic Insert: DTA and TK
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pKO2; Vector Types:Mouse Targeting; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19896442

Proper citation: RRID:Addgene_22677 Copy   


  • RRID:Addgene_22710

http://www.addgene.org/22710

Species: Drosophila melanogaster
Genetic Insert: micro RNA 9b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17901217

Proper citation: RRID:Addgene_22710 Copy   


  • RRID:Addgene_22711

http://www.addgene.org/22711

Species: Drosophila melanogaster
Genetic Insert: micro RNA 1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5348; Vector Backbone:pAc5.1A; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17901217

Proper citation: RRID:Addgene_22711 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X