Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 288 showing 5741 ~ 5760 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_102390

http://www.addgene.org/102390

Species: Arabidopsis thaliana
Genetic Insert: SLAC1
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102390 Copy   


  • RRID:Addgene_102385

http://www.addgene.org/102385

Species: Arabidopsis thaliana
Genetic Insert: SLAH3
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102385 Copy   


  • RRID:Addgene_102386

http://www.addgene.org/102386

Species: Arabidopsis thaliana
Genetic Insert: LYK5
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102386 Copy   


  • RRID:Addgene_102266

http://www.addgene.org/102266

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔlamB ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102266 Copy   


  • RRID:Addgene_102387

http://www.addgene.org/102387

Species: Arabidopsis thaliana
Genetic Insert: CIPK5
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102387 Copy   


  • RRID:Addgene_102420

http://www.addgene.org/102420

Species: Homo sapiens
Genetic Insert: SAMTOR
Vector Backbone Description: Vector Backbone:pLJC5; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29123071

Proper citation: RRID:Addgene_102420 Copy   


  • RRID:Addgene_102425

    This resource has 1+ mentions.

http://www.addgene.org/102425

Species: Homo sapiens
Genetic Insert: Rab interacting lysosomal protein
Vector Backbone Description: Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27791088

Proper citation: RRID:Addgene_102425 Copy   


  • RRID:Addgene_102267

http://www.addgene.org/102267

Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:29164072
Comments: Genotype = ΔompA ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene

Proper citation: RRID:Addgene_102267 Copy   


http://www.addgene.org/102421

Species: Mus musculus
Genetic Insert: Tet1
Vector Backbone Description: Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, but the protein product retains catalytic function.

Proper citation: RRID:Addgene_102421 Copy   


  • RRID:Addgene_102389

http://www.addgene.org/102389

Species: Arabidopsis thaliana
Genetic Insert: LYK5
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102389 Copy   


http://www.addgene.org/102422

Species: Mus musculus
Genetic Insert: Tet1 catalytic domain mutant
Vector Backbone Description: Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1.

Proper citation: RRID:Addgene_102422 Copy   


  • RRID:Addgene_102423

    This resource has 10+ mentions.

http://www.addgene.org/102423

Genetic Insert: tetracyclin-transactivator (rtTA)
Vector Backbone Description: Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG

Proper citation: RRID:Addgene_102423 Copy   


  • RRID:Addgene_102275

http://www.addgene.org/102275

Species: Homo sapiens
Genetic Insert: YTHDF2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27602518

Proper citation: RRID:Addgene_102275 Copy   


  • RRID:Addgene_102397

http://www.addgene.org/102397

Species: Arabidopsis thaliana
Genetic Insert: CBL5
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102397 Copy   


  • RRID:Addgene_102398

http://www.addgene.org/102398

Species: Arabidopsis thaliana
Genetic Insert: CBL6
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102398 Copy   


http://www.addgene.org/102391

Species: Arabidopsis thaliana
Genetic Insert: SNRK2.3
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102391 Copy   


  • RRID:Addgene_102394

http://www.addgene.org/102394

Species: Arabidopsis thaliana
Genetic Insert: CBL2
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_102394 Copy   


  • RRID:Addgene_102315

    This resource has 1+ mentions.

http://www.addgene.org/102315

Species: Homo sapiens
Genetic Insert: sgHAL
Vector Backbone Description: Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852

Proper citation: RRID:Addgene_102315 Copy   


  • RRID:Addgene_102436

http://www.addgene.org/102436

Species: E. coli
Genetic Insert: Formaldehyde repressor protein (frmR)
Vector Backbone Description: Vector Backbone:pTR47m4; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28921510

Proper citation: RRID:Addgene_102436 Copy   


  • RRID:Addgene_102437

http://www.addgene.org/102437

Genetic Insert: cAMPr
Vector Backbone Description: Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511120

Proper citation: RRID:Addgene_102437 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X