Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 287 showing 5721 ~ 5740 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_33154

http://www.addgene.org/33154

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His B; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17578907

Proper citation: RRID:Addgene_33154 Copy   


  • RRID:Addgene_33159

http://www.addgene.org/33159

Species: Caenorhabditis elegans
Genetic Insert: cog-1 3'UTR
Vector Backbone Description: Backbone Marker:Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21909094

Proper citation: RRID:Addgene_33159 Copy   


  • RRID:Addgene_33273

http://www.addgene.org/33273

Species: Mus musculus
Genetic Insert: GLIS1, Gateway casette A
Vector Backbone Description: Backbone Marker:Dr. Toshio Kitamura; Backbone Size:4700; Vector Backbone:pMXs; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21654807

Proper citation: RRID:Addgene_33273 Copy   


  • RRID:Addgene_33153

    This resource has 1+ mentions.

http://www.addgene.org/33153

Species: Drosophila melanogaster
Genetic Insert: CLK
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pAc5.1/V5-His B; Vector Types:Insect Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11158307

Proper citation: RRID:Addgene_33153 Copy   


  • RRID:Addgene_33150

http://www.addgene.org/33150

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33150 Copy   


  • RRID:Addgene_33151

http://www.addgene.org/33151

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33151 Copy   


http://www.addgene.org/147458

Species: Caenorhabditis elegans
Genetic Insert: CeSmg5-H116E
Vector Backbone Description: Vector Backbone:pCI-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23348841
Comments: ORF extraced from NCBI:NM_059528.6 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147458 Copy   


  • RRID:Addgene_14741

http://www.addgene.org/14741

Species: Homo sapiens
Genetic Insert: Keratin 18
Vector Backbone Description: Backbone Size:0; Vector Backbone:pMRB101; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7523419
Comments: Cloning information may not be accurate. Backbone could be pcDNA3.1. The plasmid was used for transfection by the Omary lab. For example, see Ku et al 2002 JBC 277:10775, Ku et al 1998 EMBO 17:1892.

Proper citation: RRID:Addgene_14741 Copy   


http://www.addgene.org/147570

Species: Drosophila melanogaster
Genetic Insert: DmPAN3_349-790-P652G
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:23932717
Comments: ORF extracted from NCBI: LD14901 Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147570 Copy   


http://www.addgene.org/147180

Species: Homo sapiens
Genetic Insert: HsTNRC6C_1281-1665
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: sequence of Hs TNRC6C isoform2 given by NCBI: NM_018996.3. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147180 Copy   


  • RRID:Addgene_14748

    This resource has 10+ mentions.

http://www.addgene.org/14748

Vector Backbone Description: Backbone Size:8174; Vector Backbone:pLKO.3G; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: A variant of pLKO.1 containing an eGFP marker rather than puromycin. Please note that the AgeI site is NOT unique for this vector, so shRNAs should be designed for cloning with EcoRI and PacI instead. Forward oligo: 5'-AATT—21bp sense—CTCGAG—21bp antisense—TTTTTTTAT-3'. Reverse oligo: 5'-AAAAAAA—21bp sense—CTCGAG—21bp antisense-3'. pLKO.3G was cloned by excising PAC-GFP from pLKO.3pgw and replacing it with eGFP from another vector using the enzymes BamHI and BsRGI.

Proper citation: RRID:Addgene_14748 Copy   


http://www.addgene.org/147618

Species: Homo sapiens
Genetic Insert: HsNot2_344-540
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24121232
Comments: ORF extracted from NCBI: NM_014515.5. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147618 Copy   


  • RRID:Addgene_14757

    This resource has 50+ mentions.

http://www.addgene.org/14757

Genetic Insert: membrane bound form of EGFP
Vector Backbone Description: Backbone Size:6122; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: mGFP is a membrane-bound form of GFP containing a palmitoylation sequence of GAP43 at its N-terminus. The mGFP insert contains V163A and S175G compared to EGFP. These mutations are not known to affect plasmid function. The Cepko lab and several other Addgene users have used this plasmid successfully in experiments. Addgene's NGS finds an IS4-like element (ISVsa5 family transposase) in the backbone that does not affect the overall plasmid function.

Proper citation: RRID:Addgene_14757 Copy   


  • RRID:Addgene_14755

    This resource has 10+ mentions.

http://www.addgene.org/14755

Species: Homo sapiens
Genetic Insert: GSK3 beta K85A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8382613
Comments: Nru I site is added to the K->A mutation

Proper citation: RRID:Addgene_14755 Copy   


  • RRID:Addgene_14756

    This resource has 1+ mentions.

http://www.addgene.org/14756

Species: Saccharomyces cerevisiae
Genetic Insert: Flpe-ERT2 fusion protein
Vector Backbone Description: Backbone Size:4779; Vector Backbone:pCAGEN; Vector Types:Mammalian Expression, Flp/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17209010
Comments: Kozak consensus sequence was added before the start ATG. Internal EcoRI site was destroyed by introducing a silent mutation.

Proper citation: RRID:Addgene_14756 Copy   


http://www.addgene.org/147501

Species: Homo sapiens
Genetic Insert: HsNot2-F502A
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24121232
Comments: ORF extracted from NCBI: NM_014515.5. Plasmids from this collection were made available to the research community and donated after the lab closed. Please note that the sequence provided by the depositing laboratory may be theoretical/predicted or based on Sanger sequencing results. There may be discrepancies between sequencing results obtained by Addgene and the depositor sequence. If an Addgene verified sequence is not available, please contact [email protected] before placing your order to request that our lab fully sequence the plasmid.

Proper citation: RRID:Addgene_147501 Copy   


  • RRID:Addgene_14754

    This resource has 50+ mentions.

http://www.addgene.org/14754

Species: Homo sapiens
Genetic Insert: GSK3 beta S9A
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7980435
Comments: S2A in the sequence does not affect function, used to introduce restriction enzyme site

Proper citation: RRID:Addgene_14754 Copy   


  • RRID:Addgene_14750

    This resource has 1+ mentions.

http://www.addgene.org/14750

Species: N. pharaonis
Genetic Insert: Mammalian codon-optimized halorhodopsin, from Natronomas pharaonis (N. pharaonis), fused with GFP at the C-terminus
Vector Backbone Description: Backbone Marker:Pavel Osten; Backbone Size:9500; Vector Backbone:FCK(1.3)GW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17375185
Comments: PLEASE CONTACT ED BOYDEN ([email protected]) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Proper citation: RRID:Addgene_14750 Copy   


  • RRID:Addgene_14724

http://www.addgene.org/14724

Species: Homo sapiens
Genetic Insert: N-ras
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11305105

Proper citation: RRID:Addgene_14724 Copy   


  • RRID:Addgene_14725

    This resource has 1+ mentions.

http://www.addgene.org/14725

Species: Homo sapiens
Genetic Insert: N-ras
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pCGN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11305105

Proper citation: RRID:Addgene_14725 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X