Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: GFP-ING2(pHD)
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21589 Copy
Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-1
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT
Proper citation: RRID:Addgene_21621 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Luk van Parijs; Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: hUbC promoter was inserted upstream of EGFP.
There are minor sequence discrepancies with depositor's sequence. Depositor is aware of the mismatches and they are acceptable.
Proper citation: RRID:Addgene_21620 Copy
Species: Homo sapiens
Genetic Insert: TNF receptor-associated factor 2
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21586 Copy
Species: Drosophila melanogaster
Genetic Insert: Enhancer of decapping 3
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5473; Vector Backbone:pAc5.1B-lambdaN-HA; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21712 Copy
Species: E. coli
Genetic Insert: LacZ
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJH271; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin
References:
Comments: The HindIII fragment of pJF3 containing URA3 UAScycl- and 300 bp of the LEU2 gene promoter and
LacZ::CS cut site was inserted into the HindIII site at the
upstream end of a promotorless LacZ gene on plasmid JH271.
The two LacZ sequences are in direct repeat orientation relative to each other.
The lambda sequences are of unknown origin
Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature.
Proper citation: RRID:Addgene_21678 Copy
Species: Mus musculus
Genetic Insert: ROSA26 G19
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Subclone of the original lambda phage, representing the ROSA26 locus, from 129S4 mice.
For more information visit -
http://research.mssm.edu/soriano/lab
Proper citation: RRID:Addgene_21711 Copy
Species: Discosoma sp.
Genetic Insert: DsRed-Max
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pDsRed-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21718 Copy
Species: evolved fluorescent protein
Genetic Insert: mNectarine fluorescent proteins
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad/His B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21717 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: polyA polymerase
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:Pet21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: See attached purification scheme
Proper citation: RRID:Addgene_21716 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ura3
Vector Backbone Description: Backbone Marker:R. Kostriken; Backbone Size:2700; Vector Backbone:pRK113; Vector Types:integration sequence; Bacterial Resistance:Ampicillin
References:
Comments: Constructed by inserting a HindIII URA3 fragment into the HindIII
site of the multiple cloning site of plasmid pRK113.
Contains the 117-bp HO cut site of
MATa inserted between the HincII and BamHI sites of pUC9 and the URA3 1.17-kb HindIII fragment at the HindlIl
site transcribed away from the HO cut site.
Proper citation: RRID:Addgene_21677 Copy
Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5188; Vector Backbone:pBabe-Hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21676 Copy
Species: Drosophila melanogaster
Genetic Insert: Trailer hitch
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:6070; Vector Backbone:pAc5.1B-EGFP; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21722 Copy
Species: Homo sapiens
Genetic Insert: p21 promoter deletion mutant
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5600; Vector Backbone:pBlueScript II KS(+); Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Chloramphenicol
References:
Comments:
Proper citation: RRID:Addgene_21728 Copy
Species: Drosophila melanogaster
Genetic Insert: Trailer hitch
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5473; Vector Backbone:pAc5.1B-lambdaN-HA; Vector Types:Mammalian Expression, Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21721 Copy
Species: Drosophila melanogaster
Genetic Insert: Decapping protein 1
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5474; Vector Backbone:pAc5.1B-lambdaN-HA; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21685 Copy
Species: Homo sapiens
Genetic Insert: IGF-II mRNA-binding protein 1
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pMSCV PIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Short means always shortest 3’UTR due to alternative polyadenylation.
Constructs for Soft-agar assay
Proper citation: RRID:Addgene_21659 Copy
Species: Homo sapiens
Genetic Insert: Cyclin D2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6295; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Long means that all functional alternative polyadenylation signals have been deleted.
Mut means that all microRNA binding sites for an indicated microRNA have been mutated.
Constructs for cell cycle
Proper citation: RRID:Addgene_21657 Copy
Species: Homo sapiens
Genetic Insert: Dicer 1
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Long means that all functional alternative polyadenylation signals have been deleted.
Mut means that all microRNA binding sites for an indicated microRNA have been mutated.
Proper citation: RRID:Addgene_21651 Copy
Species: Homo sapiens
Genetic Insert: Cyclin D2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6295; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Short means always shortest 3’UTR due to alternative polyadenylation.
Constructs for cell cycle
Proper citation: RRID:Addgene_21655 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
