Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

745,085 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Authority

Sort Ascending

Sort Descending

 Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pQTEV-DGKA
 
Resource Report
Resource Website 		RRID:Addgene_31294 diacylglycerol kinase, alpha Homo sapiens Ampicillin PMID:15998469 The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence. The Rosetta bacterial strain contains an additional plasmid. The second plasmid, pRARE, provides rare tRNAs for overexpression of recombinant proteins. It has 4694 bp and is chloramphenicol resistence. Backbone Size:4700; Vector Backbone:pQTEV; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
pLenti6/V5-DEST-RNF2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31216 RNF2 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:46 1
pLenti6/V5-DEST-SPAG5
 
Resource Report
Resource Website 		RRID:Addgene_31217 SPAG5 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Contains a one nucleotide deletion at C-term that shifts out-of-frame with V5 tag in pLent6 V5/DEST; alters last four residues (EFLS* >LNF*) Addgene 2026-11-07 01:13:46 0
pLenti6/V5-DEST-UCHL5
 
Resource Report
Resource Website 		RRID:Addgene_31219 UCHL5 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:46 0
pSG5-P190
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31285 Bcr-abl fusion protein P190 Homo sapiens Ampicillin PMID:18813851 This construct encodes a human chimeric P190-encoding Bcr/Abl oncogene. The construct was made by Leena Haataja in 1993. Backbone Size:4076; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 5
pDONR223-K-RAS V12
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31200 K-Ras Homo sapiens Spectinomycin PMID:21706014 Do NOT use this plasmid directly for transfections, you will need to recombine it into a destination vector. A set of 4 custom lentiviral vectors is available (http://www.addgene.org/25895, http://www.addgene.org/25896, http://www.addgene.org/25897, http://www.addgene.org/25890) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately. Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin G12V constitutively active Addgene 2026-11-07 01:13:46 3
pTCS-mcs
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31288 Streptomycin PMID:21238944 Backbone Size:4553; Vector Backbone:pTC-mcs; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin Addgene 2026-11-07 01:13:47 1
pLenti6/V5-DEST-ANLN
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31203 ANLN Homo sapiens Ampicillin PMID:21741599 Please note that the ANLN insert in this plasmid is based on GenBank entry BC034692, rather than the full-length transcript (GenBank entry NM_018685.2). Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti 6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:46 1
pCKFB1
 
Resource Report
Resource Website 		RRID:Addgene_31280 Clock Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4856; Vector Backbone:pFastBacHTa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
pMC1SG5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31282 Cry1 Mus musculus Ampicillin PMID:21613214 Backbone Size:4100; Vector Backbone:pSG5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 2
pLenti6/V5-DEST-ACP5
 
Resource Report
Resource Website 		RRID:Addgene_31204 ACP5 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti 6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:46 0
pLenti6/V5-DEST-HMGB1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31208 HMGB1 Homo sapiens Ampicillin PMID:21741599 Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pLenti6/V5-DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:46 1
pMAM-RecG-EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31274 RecG-EGFP E. coli Kanamycin PMID:23110454 Backbone Marker:Clontech; Backbone Size:3992; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-11-07 01:13:47 1
pMAM-RecG-ST2TaV-EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31275 RecG-ST2-TaV-EGFP E. coli Kanamycin PMID:23110454 Backbone Marker:Clontech; Backbone Size:3992; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Addgene 2026-11-07 01:13:47 1
pBMFB2
 
Resource Report
Resource Website 		RRID:Addgene_31278 Bmal1 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
pcDNA5-FRT/TO-LacR-TopBP1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_31313 TopBP1 Homo sapiens Ampicillin PMID:21502314 Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5-FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 1
pBP2MF
 
Resource Report
Resource Website 		RRID:Addgene_31279 Per2 Mus musculus Ampicillin PMID:21613214 Backbone Marker:Invitrogen; Backbone Size:4775; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
pXRDRE-puro
 
Resource Report
Resource Website 		RRID:Addgene_31270 XRDRE Ampicillin Backbone Size:1994; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0
MSCV-Nkx2-1*/Neo
 
Resource Report
Resource Website 		RRID:Addgene_31272 Nkx2-1* Mus musculus Ampicillin PMID:21471965 Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pMSCVNeo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin A shNkx2-1 insensitive Nkx2-1 cDNA was created by engineering four silent mutations using QuikChange® Lightning Site-Directed Mutagenesis (Stratagene) and the following primers: 5’ GGTCCGACCATAAAGCAAAGTGGAGCAGGACATGGCGCCATAGTCCGAG 3’ 5’ CTCGGACTATGGCGCCATGTCCTGCTCCACTTTGCTTTATGGTCGGACC 3’ followed by sequence verification and cloning into the MSCV-Puro retroviral expression vector. Addgene 2026-11-07 01:13:47 0
iXFGFR4r
 
Resource Report
Resource Website 		RRID:Addgene_31262 Xenopus FGFR4-ICD-FRB Xenopus laevis Ampicillin PMID:20013652 Backbone Size:4095; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin Addgene 2026-11-07 01:13:47 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch