Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 28 showing 541 ~ 560 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_21589

    This resource has 1+ mentions.

http://www.addgene.org/21589

Species: Mus musculus
Genetic Insert: GFP-ING2(pHD)
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12859901

Proper citation: RRID:Addgene_21589 Copy   


  • RRID:Addgene_21621

http://www.addgene.org/21621

Species: Rattus norvegicus
Genetic Insert: Dazl shRNA-1
Vector Backbone Description: Backbone Size:8264; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: Dazl shRNA sequence is - 5'-TTTGGGCTATGGATTTGTCTCATTCAAGAGATGAGACAAATCCATAGCCCTTTT

Proper citation: RRID:Addgene_21621 Copy   


  • RRID:Addgene_21620

    This resource has 1+ mentions.

http://www.addgene.org/21620

Vector Backbone Description: Backbone Marker:Luk van Parijs; Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Comments: hUbC promoter was inserted upstream of EGFP. There are minor sequence discrepancies with depositor's sequence. Depositor is aware of the mismatches and they are acceptable.

Proper citation: RRID:Addgene_21620 Copy   


  • RRID:Addgene_21586

    This resource has 1+ mentions.

http://www.addgene.org/21586

Species: Homo sapiens
Genetic Insert: TNF receptor-associated factor 2
Vector Backbone Description: Backbone Marker:Bruce Mayer Lab; Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11784851

Proper citation: RRID:Addgene_21586 Copy   


http://www.addgene.org/21712

Species: Drosophila melanogaster
Genetic Insert: Enhancer of decapping 3
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5473; Vector Backbone:pAc5.1B-lambdaN-HA; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17403906

Proper citation: RRID:Addgene_21712 Copy   


  • RRID:Addgene_21678

http://www.addgene.org/21678

Species: E. coli
Genetic Insert: LacZ
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJH271; Vector Types:centromeric plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1545810
Comments: The HindIII fragment of pJF3 containing URA3 UAScycl- and 300 bp of the LEU2 gene promoter and LacZ::CS cut site was inserted into the HindIII site at the upstream end of a promotorless LacZ gene on plasmid JH271. The two LacZ sequences are in direct repeat orientation relative to each other. The lambda sequences are of unknown origin Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature.

Proper citation: RRID:Addgene_21678 Copy   


  • RRID:Addgene_21711

http://www.addgene.org/21711

Species: Mus musculus
Genetic Insert: ROSA26 G19
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBlueScript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9108056
Comments: Subclone of the original lambda phage, representing the ROSA26 locus, from 129S4 mice. For more information visit - http://research.mssm.edu/soriano/lab

Proper citation: RRID:Addgene_21711 Copy   


  • RRID:Addgene_21718

    This resource has 10+ mentions.

http://www.addgene.org/21718

Species: Discosoma sp.
Genetic Insert: DsRed-Max
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pDsRed-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18953349

Proper citation: RRID:Addgene_21718 Copy   


  • RRID:Addgene_21717

    This resource has 1+ mentions.

http://www.addgene.org/21717

Species: evolved fluorescent protein
Genetic Insert: mNectarine fluorescent proteins
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pBad/His B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19494110

Proper citation: RRID:Addgene_21717 Copy   


  • RRID:Addgene_21716

http://www.addgene.org/21716

Species: Saccharomyces cerevisiae
Genetic Insert: polyA polymerase
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:Pet21b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15909992
Comments: See attached purification scheme

Proper citation: RRID:Addgene_21716 Copy   


  • RRID:Addgene_21677

http://www.addgene.org/21677

Species: Saccharomyces cerevisiae
Genetic Insert: Ura3
Vector Backbone Description: Backbone Marker:R. Kostriken; Backbone Size:2700; Vector Backbone:pRK113; Vector Types:integration sequence; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3065627
Comments: Constructed by inserting a HindIII URA3 fragment into the HindIII site of the multiple cloning site of plasmid pRK113. Contains the 117-bp HO cut site of MATa inserted between the HincII and BamHI sites of pUC9 and the URA3 1.17-kb HindIII fragment at the HindlIl site transcribed away from the HO cut site.

Proper citation: RRID:Addgene_21677 Copy   


http://www.addgene.org/21676

Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5188; Vector Backbone:pBabe-Hygro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17526729

Proper citation: RRID:Addgene_21676 Copy   


  • RRID:Addgene_21722

http://www.addgene.org/21722

Species: Drosophila melanogaster
Genetic Insert: Trailer hitch
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:6070; Vector Backbone:pAc5.1B-EGFP; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17403906

Proper citation: RRID:Addgene_21722 Copy   


  • RRID:Addgene_21728

http://www.addgene.org/21728

Species: Homo sapiens
Genetic Insert: p21 promoter deletion mutant
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5600; Vector Backbone:pBlueScript II KS(+); Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:8988173

Proper citation: RRID:Addgene_21728 Copy   


http://www.addgene.org/21721

Species: Drosophila melanogaster
Genetic Insert: Trailer hitch
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5473; Vector Backbone:pAc5.1B-lambdaN-HA; Vector Types:Mammalian Expression, Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17403906

Proper citation: RRID:Addgene_21721 Copy   


http://www.addgene.org/21685

Species: Drosophila melanogaster
Genetic Insert: Decapping protein 1
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5474; Vector Backbone:pAc5.1B-lambdaN-HA; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17403906

Proper citation: RRID:Addgene_21685 Copy   


  • RRID:Addgene_21659

    This resource has 1+ mentions.

http://www.addgene.org/21659

Species: Homo sapiens
Genetic Insert: IGF-II mRNA-binding protein 1
Vector Backbone Description: Backbone Size:7600; Vector Backbone:pMSCV PIG; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19703394
Comments: Short means always shortest 3’UTR due to alternative polyadenylation. Constructs for Soft-agar assay

Proper citation: RRID:Addgene_21659 Copy   


http://www.addgene.org/21657

Species: Homo sapiens
Genetic Insert: Cyclin D2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6295; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19703394
Comments: Long means that all functional alternative polyadenylation signals have been deleted. Mut means that all microRNA binding sites for an indicated microRNA have been mutated. Constructs for cell cycle

Proper citation: RRID:Addgene_21657 Copy   


http://www.addgene.org/21651

Species: Homo sapiens
Genetic Insert: Dicer 1
Vector Backbone Description: Backbone Marker:Available from Addgene (#12179); Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19703394
Comments: Long means that all functional alternative polyadenylation signals have been deleted. Mut means that all microRNA binding sites for an indicated microRNA have been mutated.

Proper citation: RRID:Addgene_21651 Copy   


http://www.addgene.org/21655

Species: Homo sapiens
Genetic Insert: Cyclin D2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6295; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19703394
Comments: Short means always shortest 3’UTR due to alternative polyadenylation. Constructs for cell cycle

Proper citation: RRID:Addgene_21655 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X