Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 276 showing 5501 ~ 5520 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/32591

Genetic Insert: IRES-EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P3-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: BMC Biotechnol. 2006 Jan 12;6:4. Development of a new bicistronic retroviral vector with strong IRES activity. Martin P, Albagli O, Poggi MC, Boulukos KE, Pognonec P. Source CNRS UMR6548, Parc Valrose, Université de Nice Sophia Antipolis, Nice, France. [email protected]

Proper citation: RRID:Addgene_32591 Copy   


  • RRID:Addgene_32636

    This resource has 10+ mentions.

http://www.addgene.org/32636

Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Addgene plasmid 32634; Backbone Size:15428; Vector Backbone:pSADdeltaG; Vector Types:Mammalian Expression, Rabies virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Comments: The genes which replaced GFP in the pcDNA-SADdeltaG-GFP plasmid were amplified by PCR using plasmids encoding mCherry and primer pairs with BamHI and NheI/NotI sequences at the ends.

Proper citation: RRID:Addgene_32636 Copy   


http://www.addgene.org/32637

Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Addgene plasmid 32634; Backbone Size:15428; Vector Backbone:pSADdeltaG; Vector Types:Mammalian Expression, Rabies virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Comments: The genes which replaced GFP in the pcDNA-SADdeltaG-GFP plasmid were amplified by PCR using plasmids encoding mCherry and primer pairs with BamHI and NheI/NotI sequences at the ends.

Proper citation: RRID:Addgene_32637 Copy   


  • RRID:Addgene_32634

    This resource has 10+ mentions.

http://www.addgene.org/32634

Species: Rabies virus
Genetic Insert: B19N, B19P, B19M and B19L
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5015; Vector Backbone:pcDNA3.1/Zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879
Comments: To construct the rabies virus genomic cDNA, several pieces of rabies genomic cDNA were ligated with unique restriction enzyme sites, AgeI, MluI, BlpI, BstZ17I, and BstBI. Addition of HamRz and HdvRz sequences were performed by PCR using synthesized primers designed to attach these ribozyme sequences. The pSADdeltaG-F3 has 3 unique restriction enzyme sites Sbf1, Srf1 and NheI for cloning the first gene and 3 unique restriction enzyme sites PacI, AscI and SacII for cloning the second gene between B19M and B19L.

Proper citation: RRID:Addgene_32634 Copy   


  • RRID:Addgene_32638

    This resource has 1+ mentions.

http://www.addgene.org/32638

Genetic Insert: DsRed2
Vector Backbone Description: Backbone Marker:Addgene plasmid 32634; Backbone Size:15428; Vector Backbone:pSADdeltaG; Vector Types:Mammalian Expression, Rabies virus; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21867879

Proper citation: RRID:Addgene_32638 Copy   


  • RRID:Addgene_32582

http://www.addgene.org/32582

Species: Homo sapiens
Genetic Insert: Synapsin I promoter
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P1-P5r; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: Gene Therapy 14, 872-882 (June 2007) doi:10.1038/sj.gt.3302924 Efficient gene transduction of neurons by lentivirus with enhanced neuron-specific promoters H Hioki, H Kameda, H Nakamura, T Okunomiya, K Ohira, K Nakamura, M Kuroda, T Furuta and T Kaneko

Proper citation: RRID:Addgene_32582 Copy   


http://www.addgene.org/32588

Genetic Insert: Intronic Luciferase miRNA and EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P3-P2; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: LucmiRNA atttgtattcagcccatatcgg Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.

Proper citation: RRID:Addgene_32588 Copy   


  • RRID:Addgene_32622

http://www.addgene.org/32622

Species: Gallus gallus
Genetic Insert: GAPDH shRNA #2
Vector Backbone Description: Vector Backbone:pRFP RNAiC-1; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21060789

Proper citation: RRID:Addgene_32622 Copy   


http://www.addgene.org/32586

Genetic Insert: Intronic HCN1miRNA and EGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR221 P4r-P3r; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:21772812
Comments: HCN1miRNA TAAAGACGACAGTAGGTATCAG Du, G., Yonekubo, J., Zeng, Y., Osisami, M., and Frohman, M. A. (2006). Design of expression vectors for RNA interference based on miRNAs and RNA splicing. FEBS J. 273, 5421–5427.

Proper citation: RRID:Addgene_32586 Copy   


  • RRID:Addgene_32620

http://www.addgene.org/32620

Species: Gallus gallus
Genetic Insert: TRbeta shRNA #1
Vector Backbone Description: Vector Backbone:pRFP RNAiC-1; Vector Types:RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21060789

Proper citation: RRID:Addgene_32620 Copy   


http://www.addgene.org/32628

Genetic Insert: Sce
Vector Backbone Description: Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21743461

Proper citation: RRID:Addgene_32628 Copy   


http://www.addgene.org/32731

Species: Homo sapiens
Genetic Insert: CCND1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372

Proper citation: RRID:Addgene_32731 Copy   


http://www.addgene.org/32732

Species: Homo sapiens
Genetic Insert: CCND1 Promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372

Proper citation: RRID:Addgene_32732 Copy   


  • RRID:Addgene_32851

    This resource has 1+ mentions.

http://www.addgene.org/32851

Species: Homo sapiens
Genetic Insert: DCX
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed2-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15173193

Proper citation: RRID:Addgene_32851 Copy   


http://www.addgene.org/32734

Species: Homo sapiens
Genetic Insert: CCND1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372

Proper citation: RRID:Addgene_32734 Copy   


  • RRID:Addgene_32855

    This resource has 1+ mentions.

http://www.addgene.org/32855

Species: Mus musculus
Genetic Insert: Talin 1 Rod aa 434-2541
Vector Backbone Description: Backbone Marker:BD Clontech; Backbone Size:4749; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17114441
Comments: Please note that both the full plasmid sequence from the depositing laboratory and Addgene's sequencing results indicate a K673N mutation/SNP when the sequences are compared to GenBank entry NP_035732.2. The depositing laboratory states that this difference is not a concern for the function of the plasmid. The most appropriate reference sequence for the Talin1 insert in the plasmid is GenBank accession number CAA39588.1.

Proper citation: RRID:Addgene_32855 Copy   


http://www.addgene.org/32739

Species: Homo sapiens
Genetic Insert: TCF4E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372

Proper citation: RRID:Addgene_32739 Copy   


http://www.addgene.org/32737

Species: Homo sapiens
Genetic Insert: CCND1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3Basic; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10201372
Comments: There is a 1bp mismatch in the sequence that does not affect plasmid function.

Proper citation: RRID:Addgene_32737 Copy   


  • RRID:Addgene_32859

http://www.addgene.org/32859

Species: Homo sapiens
Genetic Insert: MLH1
Vector Backbone Description: Backbone Marker:Structural Genomics Consortium (Addgene plasmid 26096); Backbone Size:7325; Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3RBN. http://www.thesgc.org/structures/3RBN/

Proper citation: RRID:Addgene_32859 Copy   


  • RRID:Addgene_32720

http://www.addgene.org/32720

Genetic Insert: luciferase
Vector Backbone Description: Backbone Marker:Jaensich laboratory; Backbone Size:6120; Vector Backbone:pBS31'-RBGpA; Vector Types:Mouse Targeting, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21458673

Proper citation: RRID:Addgene_32720 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X