Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pUG-125 Resource Report Resource Website |
RRID:Addgene_104636 | HIS-Ubq_UBA1_HA-UBC8_GST-AvrPtoB-F/A_EL4 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Level 2 construct to be used as negative control, contains a Ubq-E1-E2-E3 combination with mutated E3 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | AvrPtoB-Phe479Ala | Addgene | 2026-09-19 02:04:24 | 0 |
|
pUG-124 Resource Report Resource Website |
RRID:Addgene_104635 | HIS-Ubq_UBA1_HA-UBC8_GST-AvrPtoB_EL4 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Level 2 construct to be used as positive control, contains a functional Ubq-E1-E2-E3 combination | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:24 | 0 | |
|
pUG-300 Resource Report Resource Website |
RRID:Addgene_104729 | HIS-Ubq_UBA1_HA-UBC9_EL3 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:24 | 0 | ||
|
pAAV-UAS-Luciferase Resource Report Resource Website |
RRID:Addgene_104840 | Luciferase | Synthetic | Ampicillin | PMID:29189201 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pUG-295 Resource Report Resource Website |
RRID:Addgene_104725 | HIS-Ubq_UBA1_HA-UBC3_EL3 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:24 | 0 | ||
|
pLX208-beta-arrestin2-HA-TEV219 Resource Report Resource Website 1+ mentions |
RRID:Addgene_104846 | beta-arrestin2-HA-TEV219 | Synthetic | Ampicillin | PMID:29189201 | Vector Backbone:pLX208; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 1 | ||
|
pMP71-HLA-B15-His Resource Report Resource Website |
RRID:Addgene_104848 | major histocompatibility complex, class I, B | Homo sapiens | Ampicillin | Backbone Size:5000; Vector Backbone:pMP71; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2 differences compared to original B15: L2->R and M4-> T, no change was observed on final product. | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pAAV-b2AR-hLOV1-TEVcs-FLAG-GAL4-V5 Resource Report Resource Website |
RRID:Addgene_104842 | hLOV1-TEVcs-FLAG-GAL4-V5 | Synthetic | Ampicillin | PMID:29189201 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pAAV-AVPR2-eLOV-TEVcs-FLAG-GAL4-V5 Resource Report Resource Website |
RRID:Addgene_104844 | AVPR2-eLOV-TEVcs-FLAG-GAL4-V5 | Synthetic | Ampicillin | PMID:29189201 | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pMP71-HLA-B0702-His Resource Report Resource Website 1+ mentions |
RRID:Addgene_104850 | major histocompatibility complex, class I, B | Homo sapiens | Ampicillin | PMID:31022685 | Backbone Size:5000; Vector Backbone:pMP71; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 1 | ||
|
pUG-307 Resource Report Resource Website |
RRID:Addgene_104736 | HIS-Ubq_UBA1_HA-UBC16_EL3 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pUG-309 Resource Report Resource Website |
RRID:Addgene_104738 | HIS-Ubq_UBA1_HA-UBC18_EL3 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pPKm-105 Resource Report Resource Website |
RRID:Addgene_104853 | PhyB NT GBD | Ampicillin | PMID:29301067 | Construct contains amino acids 1-621 PhyB [NCBI NP_001325249.1]. | Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pUG-302 Resource Report Resource Website |
RRID:Addgene_104731 | HIS-Ubq_UBA1_HA-UBC11_EL3 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:24 | 0 | ||
|
pUG-304 Resource Report Resource Website |
RRID:Addgene_104733 | HIS-Ubq_UBA1_HA-UBC13_EL3 | Arabidopsis thaliana | Kanamycin | PMID:29194629 | Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:25 | 0 | ||
|
pPKm-163 Resource Report Resource Website |
RRID:Addgene_104854 | PIF3-GBD | Ampicillin | PMID:29301067 | Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-09-19 02:04:25 | 0 | |||
|
pSC10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_104784 | Spectinomycin | PMID:29087011 | Alternative name of plasmid: pAH595 | Vector Backbone:pENTR top; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin | Addgene | 2026-09-19 02:04:25 | 1 | |||
|
pSC6 Resource Report Resource Website |
RRID:Addgene_104780 | Chloramphenicol and Kanamycin | PMID:29087011 | 112-31:9.1. Alternative name of plasmid: pSG218RG. | Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Kanamycin | Addgene | 2026-09-19 02:04:25 | 0 | |||
|
pSC49 Resource Report Resource Website |
RRID:Addgene_104823 | Glyma17g11235 | Kanamycin | 112-151:1.1. Alternative name of plasmid: pSG218UG | Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:25 | 0 | |||
|
pSC51 Resource Report Resource Website |
RRID:Addgene_104825 | Glyma.12g075700, Glyma.11g145900 | Kanamycin | PMID:29087011 | 112-277:2.1. Alternative name of plasmid: pSG218GG. Please note that this plasmid contains two (ttagctggaatcatgtttac) gRNA cassettes. The plasmid still functions as described in the publication. | Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin | Addgene | 2026-09-19 02:04:25 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.