Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC8_GST-AvrPtoB-F/A_EL4
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Comments: Level 2 construct to be used as negative control, contains a Ubq-E1-E2-E3 combination with mutated E3
Proper citation: RRID:Addgene_104636 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC8_GST-AvrPtoB_EL4
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Comments: Level 2 construct to be used as positive control, contains a functional Ubq-E1-E2-E3 combination
Proper citation: RRID:Addgene_104635 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC9_EL3
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Proper citation: RRID:Addgene_104729 Copy
Species: Synthetic
Genetic Insert: Luciferase
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29189201
Proper citation: RRID:Addgene_104840 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC3_EL3
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Proper citation: RRID:Addgene_104725 Copy
Species: Synthetic
Genetic Insert: beta-arrestin2-HA-TEV219
Vector Backbone Description: Vector Backbone:pLX208; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29189201
Proper citation: RRID:Addgene_104846 Copy
Species: Homo sapiens
Genetic Insert: major histocompatibility complex, class I, B
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pMP71; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_104848 Copy
Species: Synthetic
Genetic Insert: hLOV1-TEVcs-FLAG-GAL4-V5
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29189201
Proper citation: RRID:Addgene_104842 Copy
Species: Synthetic
Genetic Insert: AVPR2-eLOV-TEVcs-FLAG-GAL4-V5
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29189201
Proper citation: RRID:Addgene_104844 Copy
Species: Homo sapiens
Genetic Insert: major histocompatibility complex, class I, B
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pMP71; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31022685
Proper citation: RRID:Addgene_104850 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC16_EL3
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Proper citation: RRID:Addgene_104736 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC18_EL3
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Proper citation: RRID:Addgene_104738 Copy
Genetic Insert: PhyB NT GBD
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301067
Comments: Construct contains amino acids 1-621 PhyB [NCBI NP_001325249.1].
Proper citation: RRID:Addgene_104853 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC11_EL3
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Proper citation: RRID:Addgene_104731 Copy
Species: Arabidopsis thaliana
Genetic Insert: HIS-Ubq_UBA1_HA-UBC13_EL3
Vector Backbone Description: Backbone Size:5190; Vector Backbone:pET-28GG; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29194629
Proper citation: RRID:Addgene_104733 Copy
Genetic Insert: PIF3-GBD
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29301067
Proper citation: RRID:Addgene_104854 Copy
Vector Backbone Description: Vector Backbone:pENTR top; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:29087011
Comments: Alternative name of plasmid: pAH595
Proper citation: RRID:Addgene_104784 Copy
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:29087011
Comments: 112-31:9.1. Alternative name of plasmid: pSG218RG.
Proper citation: RRID:Addgene_104780 Copy
Genetic Insert: Glyma17g11235
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: 112-151:1.1. Alternative name of plasmid: pSG218UG
Proper citation: RRID:Addgene_104823 Copy
Genetic Insert: Glyma.12g075700, Glyma.11g145900
Vector Backbone Description: Vector Backbone:pSC218; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29087011
Comments: 112-277:2.1. Alternative name of plasmid: pSG218GG. Please note that this plasmid contains two (ttagctggaatcatgtttac) gRNA cassettes. The plasmid still functions as described in the publication.
Proper citation: RRID:Addgene_104825 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
