Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21525 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21524 Copy
Species: Homo sapiens
Genetic Insert: Ago2
Vector Backbone Description: Backbone Marker:SIGMA; Backbone Size:4752; Vector Backbone:p3XFLAG-myc-CMV-24; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21529 Copy
Species: Homo sapiens
Genetic Insert: Cited2 Promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:PGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid
Proper citation: RRID:Addgene_21486 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pCG-GST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: In our JCS paper (Li et al. J Cell Sci. 2008 Dec 15;121(Pt 24):4134-44), a new isoform of GW182 was identified with an extra N-terminal 253-amino-acid. That is why the name of these two clones changed from the original GW182D1a (aa1-250) and GW182D1(aa1-498) to GW1D1a(aa254-503) and GW1D1(aa254-751), respectively.
Proper citation: RRID:Addgene_21523 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21522 Copy
Species: Homo sapiens
Genetic Insert: Cited2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: HA tag added to 5'end of the cited2 cDNA using a blunt-ha-stop-xho oligo. The insert was ligated into the EcoRI/XhoI sites of pcDNA3
Proper citation: RRID:Addgene_21488 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21521 Copy
Species: Mus musculus
Genetic Insert: Stra8 promoter
Vector Backbone Description: Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: This is a 3rd generation lentiviral plasmid.
Proper citation: RRID:Addgene_21619 Copy
Species:
Genetic Insert: Oct3 shRNA
Vector Backbone Description: Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: Oct3 shRNA sequence is - 5'-TTGTTTGAACCGTGTGAGGTGGAACTTCAAGAGAGTTCCACCTCACACGGTTCT
This is a 3rd generation lentiviral plasmid.
This plasmid worked for mouse and rat Oct4 knockdown, but it was not tested in human cells.
Proper citation: RRID:Addgene_21618 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: This is a 3rd generation lentiviral plasmid.
Proper citation: RRID:Addgene_21617 Copy
Species: Mus musculus
Genetic Insert: Bmi-1
Vector Backbone Description: Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW.
Proper citation: RRID:Addgene_21577 Copy
Species: Homo sapiens
Genetic Insert: ALIX
Vector Backbone Description: Backbone Size:4700; Vector Backbone:mCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21504 Copy
Species: Mus musculus
Genetic Insert: TNF receptor-associated factor 6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21624 Copy
Species: Homo sapiens
Genetic Insert: ALIX
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21502 Copy
Species: Caenorhabditis elegans
Genetic Insert: (Gly)5Ala::GFP(w introns)::tbb-2 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_21509 Copy
Species: Homo sapiens
Genetic Insert: mitogen-activated protein kinase kinase kinase 3
Vector Backbone Description: Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: lysine mutant activity unknown
Proper citation: RRID:Addgene_21585 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: M2-FLAG,
Lysine mutant, inactive
Proper citation: RRID:Addgene_21583 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: M2-FLAG
Proper citation: RRID:Addgene_21582 Copy
Species: Homo sapiens
Genetic Insert: CEP55-EABR (ESCRT and ALIX Binding Region) domain
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: PNC to MGS mut in beginning of protein; author says that this is the plasmid that was used in publication.
Proper citation: RRID:Addgene_21501 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.