Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 27 showing 521 ~ 540 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/21525

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21525 Copy   


http://www.addgene.org/21524

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21524 Copy   


  • RRID:Addgene_21529

http://www.addgene.org/21529

Species: Homo sapiens
Genetic Insert: Ago2
Vector Backbone Description: Backbone Marker:SIGMA; Backbone Size:4752; Vector Backbone:p3XFLAG-myc-CMV-24; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21529 Copy   


  • RRID:Addgene_21486

http://www.addgene.org/21486

Species: Homo sapiens
Genetic Insert: Cited2 Promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:PGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid

Proper citation: RRID:Addgene_21486 Copy   


  • RRID:Addgene_21523

http://www.addgene.org/21523

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:7000; Vector Backbone:pCG-GST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: In our JCS paper (Li et al. J Cell Sci. 2008 Dec 15;121(Pt 24):4134-44), a new isoform of GW182 was identified with an extra N-terminal 253-amino-acid. That is why the name of these two clones changed from the original GW182D1a (aa1-250) and GW182D1(aa1-498) to GW1D1a(aa254-503) and GW1D1(aa254-751), respectively.

Proper citation: RRID:Addgene_21523 Copy   


  • RRID:Addgene_21522

http://www.addgene.org/21522

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21522 Copy   


  • RRID:Addgene_21488

http://www.addgene.org/21488

Species: Homo sapiens
Genetic Insert: Cited2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: HA tag added to 5'end of the cited2 cDNA using a blunt-ha-stop-xho oligo. The insert was ligated into the EcoRI/XhoI sites of pcDNA3

Proper citation: RRID:Addgene_21488 Copy   


http://www.addgene.org/21521

Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21521 Copy   


  • RRID:Addgene_21619

    This resource has 1+ mentions.

http://www.addgene.org/21619

Species: Mus musculus
Genetic Insert: Stra8 promoter
Vector Backbone Description: Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: This is a 3rd generation lentiviral plasmid.

Proper citation: RRID:Addgene_21619 Copy   


  • RRID:Addgene_21618

http://www.addgene.org/21618

Species:
Genetic Insert: Oct3 shRNA
Vector Backbone Description: Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: Oct3 shRNA sequence is - 5'-TTGTTTGAACCGTGTGAGGTGGAACTTCAAGAGAGTTCCACCTCACACGGTTCT This is a 3rd generation lentiviral plasmid. This plasmid worked for mouse and rat Oct4 knockdown, but it was not tested in human cells.

Proper citation: RRID:Addgene_21618 Copy   


  • RRID:Addgene_21617

http://www.addgene.org/21617

Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: This is a 3rd generation lentiviral plasmid.

Proper citation: RRID:Addgene_21617 Copy   


  • RRID:Addgene_21577

    This resource has 1+ mentions.

http://www.addgene.org/21577

Species: Mus musculus
Genetic Insert: Bmi-1
Vector Backbone Description: Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW.

Proper citation: RRID:Addgene_21577 Copy   


  • RRID:Addgene_21504

    This resource has 10+ mentions.

http://www.addgene.org/21504

Species: Homo sapiens
Genetic Insert: ALIX
Vector Backbone Description: Backbone Size:4700; Vector Backbone:mCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_21504 Copy   


  • RRID:Addgene_21624

    This resource has 10+ mentions.

http://www.addgene.org/21624

Species: Mus musculus
Genetic Insert: TNF receptor-associated factor 6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21624 Copy   


  • RRID:Addgene_21502

http://www.addgene.org/21502

Species: Homo sapiens
Genetic Insert: ALIX
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_21502 Copy   


  • RRID:Addgene_21509

    This resource has 1+ mentions.

http://www.addgene.org/21509

Species: Caenorhabditis elegans
Genetic Insert: (Gly)5Ala::GFP(w introns)::tbb-2 3'UTR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_21509 Copy   


  • RRID:Addgene_21585

http://www.addgene.org/21585

Species: Homo sapiens
Genetic Insert: mitogen-activated protein kinase kinase kinase 3
Vector Backbone Description: Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: lysine mutant activity unknown

Proper citation: RRID:Addgene_21585 Copy   


  • RRID:Addgene_21583

    This resource has 1+ mentions.

http://www.addgene.org/21583

Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: M2-FLAG, Lysine mutant, inactive

Proper citation: RRID:Addgene_21583 Copy   


  • RRID:Addgene_21582

http://www.addgene.org/21582

Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: M2-FLAG

Proper citation: RRID:Addgene_21582 Copy   


  • RRID:Addgene_21501

http://www.addgene.org/21501

Species: Homo sapiens
Genetic Insert: CEP55-EABR (ESCRT and ALIX Binding Region) domain
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: PNC to MGS mut in beginning of protein; author says that this is the plasmid that was used in publication.

Proper citation: RRID:Addgene_21501 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X