Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
GFP-D1a_W2-3(aa318-399) Resource Report Resource Website |
RRID:Addgene_21525 | TNRC6A | Homo sapiens | Ampicillin | PMID:19324964 | Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contain aa318-399 | 2026-08-01 01:10:17 | 0 | |
|
GFP-D1a_W1-2(aa270-346) Resource Report Resource Website |
RRID:Addgene_21524 | TNRC6A | Homo sapiens | Ampicillin | PMID:19324964 | Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contain aa270-346 | 2026-08-01 01:10:06 | 0 | |
|
FLAG-PAZ(aa1-480) Resource Report Resource Website |
RRID:Addgene_21529 | Ago2 | Homo sapiens | Ampicillin | PMID:19324964 | Backbone Marker:SIGMA; Backbone Size:4752; Vector Backbone:p3XFLAG-myc-CMV-24; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contain only aa1-480 | 2026-08-01 01:10:06 | 0 | |
|
PGL3-MK17 Resource Report Resource Website |
RRID:Addgene_21486 | Cited2 Promoter | Homo sapiens | Ampicillin | PMID:10552932 | Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid | Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:PGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:17 | 0 | |
|
GST-GW1D1(aa254-751) Resource Report Resource Website |
RRID:Addgene_21523 | TNRC6A | Homo sapiens | Ampicillin | PMID:19324964 | In our JCS paper (Li et al. J Cell Sci. 2008 Dec 15;121(Pt 24):4134-44), a new isoform of GW182 was identified with an extra N-terminal 253-amino-acid. That is why the name of these two clones changed from the original GW182D1a (aa1-250) and GW182D1(aa1-498) to GW1D1a(aa254-503) and GW1D1(aa254-751), respectively. | Backbone Size:7000; Vector Backbone:pCG-GST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contain aa254-751 | 2026-08-01 01:10:06 | 0 |
|
GFP-GW1D1aMut(W>A) Resource Report Resource Website |
RRID:Addgene_21522 | TNRC6A | Homo sapiens | Ampicillin | PMID:19324964 | Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contain aa254-503, mutate every tryptophan (total 5 of them) to alanine | 2026-08-01 01:10:17 | 0 | |
|
SB53 Resource Report Resource Website |
RRID:Addgene_21488 | Cited2 | Homo sapiens | Ampicillin | PMID:9887100 | HA tag added to 5'end of the cited2 cDNA using a blunt-ha-stop-xho oligo. The insert was ligated into the EcoRI/XhoI sites of pcDNA3 | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | aa1-65 deleted | 2026-08-01 01:10:05 | 0 |
|
GFP-GW1D1b(aa502-751) Resource Report Resource Website |
RRID:Addgene_21521 | TNRC6A | Homo sapiens | Ampicillin | PMID:19324964 | Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | contain aa502-751 | 2026-08-01 01:10:05 | 0 | |
|
pLSG (stra8) Resource Report Resource Website 1+ mentions |
RRID:Addgene_21619 | Stra8 promoter | Mus musculus | Ampicillin | PMID:18719224 | This is a 3rd generation lentiviral plasmid. | Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:06 | 1 | |
|
pLLNeo-Oct3 Resource Report Resource Website |
RRID:Addgene_21618 | Oct3 shRNA | Ampicillin | PMID:18719224 | Oct3 shRNA sequence is - 5'-TTGTTTGAACCGTGTGAGGTGGAACTTCAAGAGAGTTCCACCTCACACGGTTCT This is a 3rd generation lentiviral plasmid. This plasmid worked for mouse and rat Oct4 knockdown, but it was not tested in human cells. | Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:18 | 0 | ||
|
pLLNeo Resource Report Resource Website |
RRID:Addgene_21617 | Ampicillin | PMID:18719224 | This is a 3rd generation lentiviral plasmid. | Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:06 | 0 | |||
|
Bmi1-overexpression Resource Report Resource Website 1+ mentions |
RRID:Addgene_21577 | Bmi-1 | Mus musculus | Ampicillin | PMID:18371338 | Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW. | Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:06 | 1 | |
|
mCherry-hALIX Resource Report Resource Website 10+ mentions |
RRID:Addgene_21504 | ALIX | Homo sapiens | Kanamycin | PMID:18948538 | Backbone Size:4700; Vector Backbone:mCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | none | 2026-08-01 01:10:17 | 13 | |
|
FLAG-TRAF6-wt Resource Report Resource Website 10+ mentions |
RRID:Addgene_21624 | TNF receptor-associated factor 6 | Mus musculus | Ampicillin | PMID:15456887 | Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:19 | 24 | ||
|
pGST2-ALIX (795-811) Resource Report Resource Website |
RRID:Addgene_21502 | ALIX | Homo sapiens | Ampicillin | PMID:18948538 | Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | none | 2026-08-01 01:10:05 | 0 | |
|
pJA256 Resource Report Resource Website 1+ mentions |
RRID:Addgene_21509 | (Gly)5Ala::GFP(w introns)::tbb-2 3'UTR | Caenorhabditis elegans | Kanamycin | PMID:21637852 | Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-08-01 01:10:05 | 2 | ||
|
pMT2-MEKK3-K392A Resource Report Resource Website |
RRID:Addgene_21585 | mitogen-activated protein kinase kinase kinase 3 | Homo sapiens | Ampicillin | PMID:11784851 | lysine mutant activity unknown | Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Lysine 392 to Arginine | 2026-08-01 01:10:18 | 0 |
|
pCMV5-FLAG-MKK6-K82M Resource Report Resource Website 1+ mentions |
RRID:Addgene_21583 | MKK6 | Homo sapiens | Ampicillin | PMID:9712898 | M2-FLAG, Lysine mutant, inactive | Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | lysine 82 to methionine | 2026-08-01 01:10:06 | 1 |
|
pCMV5-FLAG-MKK6 Resource Report Resource Website |
RRID:Addgene_21582 | MKK6 | Homo sapiens | Ampicillin | PMID:9712898 | M2-FLAG | Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:10:06 | 0 | |
|
pGST2-CeEP55 Resource Report Resource Website |
RRID:Addgene_21501 | CEP55-EABR (ESCRT and ALIX Binding Region) domain | Homo sapiens | Ampicillin | PMID:18948538 | PNC to MGS mut in beginning of protein; author says that this is the plasmid that was used in publication. | Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Q230 (CAG changed to TAA), Q218 (CAA changed to TAA) | 2026-08-01 01:10:05 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
