Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
GFP-D1a_W2-3(aa318-399)
 
Resource Report
Resource Website
RRID:Addgene_21525 TNRC6A Homo sapiens Ampicillin PMID:19324964 Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa318-399 2026-08-01 01:10:17 0
GFP-D1a_W1-2(aa270-346)
 
Resource Report
Resource Website
RRID:Addgene_21524 TNRC6A Homo sapiens Ampicillin PMID:19324964 Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa270-346 2026-08-01 01:10:06 0
FLAG-PAZ(aa1-480)
 
Resource Report
Resource Website
RRID:Addgene_21529 Ago2 Homo sapiens Ampicillin PMID:19324964 Backbone Marker:SIGMA; Backbone Size:4752; Vector Backbone:p3XFLAG-myc-CMV-24; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain only aa1-480 2026-08-01 01:10:06 0
PGL3-MK17
 
Resource Report
Resource Website
RRID:Addgene_21486 Cited2 Promoter Homo sapiens Ampicillin PMID:10552932 Contains bases -3375 to +65 of cited2 genomic sequence. Constructed by cloning a 2.8kb KpnI/AvrII genomic fragment into the MK14 plasmid Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:PGL3 Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:10:17 0
GST-GW1D1(aa254-751)
 
Resource Report
Resource Website
RRID:Addgene_21523 TNRC6A Homo sapiens Ampicillin PMID:19324964 In our JCS paper (Li et al. J Cell Sci. 2008 Dec 15;121(Pt 24):4134-44), a new isoform of GW182 was identified with an extra N-terminal 253-amino-acid. That is why the name of these two clones changed from the original GW182D1a (aa1-250) and GW182D1(aa1-498) to GW1D1a(aa254-503) and GW1D1(aa254-751), respectively. Backbone Size:7000; Vector Backbone:pCG-GST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa254-751 2026-08-01 01:10:06 0
GFP-GW1D1aMut(W>A)
 
Resource Report
Resource Website
RRID:Addgene_21522 TNRC6A Homo sapiens Ampicillin PMID:19324964 Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa254-503, mutate every tryptophan (total 5 of them) to alanine 2026-08-01 01:10:17 0
SB53
 
Resource Report
Resource Website
RRID:Addgene_21488 Cited2 Homo sapiens Ampicillin PMID:9887100 HA tag added to 5'end of the cited2 cDNA using a blunt-ha-stop-xho oligo. The insert was ligated into the EcoRI/XhoI sites of pcDNA3 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin aa1-65 deleted 2026-08-01 01:10:05 0
GFP-GW1D1b(aa502-751)
 
Resource Report
Resource Website
RRID:Addgene_21521 TNRC6A Homo sapiens Ampicillin PMID:19324964 Vector Backbone:custom-made pDEST:gfp vector; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contain aa502-751 2026-08-01 01:10:05 0
pLSG (stra8)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21619 Stra8 promoter Mus musculus Ampicillin PMID:18719224 This is a 3rd generation lentiviral plasmid. Backbone Size:7048; Vector Backbone:pLLU2G; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:10:06 1
pLLNeo-Oct3
 
Resource Report
Resource Website
RRID:Addgene_21618 Oct3 shRNA Ampicillin PMID:18719224 Oct3 shRNA sequence is - 5'-TTGTTTGAACCGTGTGAGGTGGAACTTCAAGAGAGTTCCACCTCACACGGTTCT This is a 3rd generation lentiviral plasmid. This plasmid worked for mouse and rat Oct4 knockdown, but it was not tested in human cells. Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:18 0
pLLNeo
 
Resource Report
Resource Website
RRID:Addgene_21617 Ampicillin PMID:18719224 This is a 3rd generation lentiviral plasmid. Backbone Size:7861; Vector Backbone:pLLU2G; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:10:06 0
Bmi1-overexpression
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21577 Bmi-1 Mus musculus Ampicillin PMID:18371338 Bmi-1 cDNA cloned into pIRES-eGFP first. The Bmi1-ires-eGFP was then cut out and cloned into FUGW. Backbone Marker:D. Baltimore; Backbone Size:9941; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:10:06 1
mCherry-hALIX
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_21504 ALIX Homo sapiens Kanamycin PMID:18948538 Backbone Size:4700; Vector Backbone:mCherry; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin none 2026-08-01 01:10:17 13
FLAG-TRAF6-wt
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_21624 TNF receptor-associated factor 6 Mus musculus Ampicillin PMID:15456887 Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:19 24
pGST2-ALIX (795-811)
 
Resource Report
Resource Website
RRID:Addgene_21502 ALIX Homo sapiens Ampicillin PMID:18948538 Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin none 2026-08-01 01:10:05 0
pJA256
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21509 (Gly)5Ala::GFP(w introns)::tbb-2 3'UTR Caenorhabditis elegans Kanamycin PMID:21637852 Backbone Marker:Invitrogen; Backbone Size:2639; Vector Backbone:pDONR P2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-01 01:10:05 2
pMT2-MEKK3-K392A
 
Resource Report
Resource Website
RRID:Addgene_21585 mitogen-activated protein kinase kinase kinase 3 Homo sapiens Ampicillin PMID:11784851 lysine mutant activity unknown Backbone Marker:Unknown; Backbone Size:5100; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Lysine 392 to Arginine 2026-08-01 01:10:18 0
pCMV5-FLAG-MKK6-K82M
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_21583 MKK6 Homo sapiens Ampicillin PMID:9712898 M2-FLAG, Lysine mutant, inactive Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin lysine 82 to methionine 2026-08-01 01:10:06 1
pCMV5-FLAG-MKK6
 
Resource Report
Resource Website
RRID:Addgene_21582 MKK6 Homo sapiens Ampicillin PMID:9712898 M2-FLAG Backbone Marker:Dr. David Russell, UTSW; Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:10:06 0
pGST2-CeEP55
 
Resource Report
Resource Website
RRID:Addgene_21501 CEP55-EABR (ESCRT and ALIX Binding Region) domain Homo sapiens Ampicillin PMID:18948538 PNC to MGS mut in beginning of protein; author says that this is the plasmid that was used in publication. Backbone Size:5000; Vector Backbone:pGST2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Q230 (CAG changed to TAA), Q218 (CAA changed to TAA) 2026-08-01 01:10:05 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.