Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pTRERF1.1.0-gDNA Resource Report Resource Website |
RRID:Addgene_176384 | TRERF1 gRNA | Homo sapiens | Ampicillin | gRNA sequence listed also includes (uncloned) PAM | Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:56 | 0 | ||
|
pGEM-Isce-Tol2-Tn5-neo Resource Report Resource Website |
RRID:Addgene_176619 | I-SceI sites, Tol2 repeats and Tn5-neo cassette | Synthetic | Ampicillin and Kanamycin | PMID:34751773 | Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-T; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin | 2026-08-01 01:08:58 | 0 | ||
|
pET29b-mVenus-dspB(E184Q W330Y)-6xHis Resource Report Resource Website 1+ mentions |
RRID:Addgene_176577 | Dispersin B | Aggregatibacter actinomycetemcomitans | Kanamycin | PMID:35379435 | Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | E184Q W330Y | 2026-08-01 01:08:58 | 1 | |
|
Cry2PHR-IBAR-WH2 Resource Report Resource Website |
RRID:Addgene_176603 | Cry2PHR-mCherry-IBAR-WH2 | Homo sapiens | Kanamycin | PMID:35987384 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-01 01:08:58 | 0 | |
|
Cry2PHR - IBAR Resource Report Resource Website |
RRID:Addgene_176602 | Cry2PHR-mCherry-IBAR | Homo sapiens | Kanamycin | PMID:35987384 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-01 01:08:58 | 0 | |
|
IBAR-Cry2PHR Resource Report Resource Website |
RRID:Addgene_176604 | IBAR-Cry2PHR-mCherry | Homo sapiens | Kanamycin | PMID:35987384 | Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. | Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-01 01:08:58 | 0 | |
|
pM-TagRFP657 Resource Report Resource Website |
RRID:Addgene_176563 | TagRFP657 | Synthetic | Ampicillin | PMID:35314781 | Please note: Plasmid contains E38G and L304S mutations in MET17. These mutations are not known to affect plasmid function. | Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:58 | 0 | |
|
pH-TagRFP657 Resource Report Resource Website |
RRID:Addgene_176560 | TagRFP657 | Synthetic | Ampicillin | PMID:35314781 | Vector Backbone:pH; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:58 | 0 | ||
|
pSL1180-HR-PUbEGFP-NLS Resource Report Resource Website |
RRID:Addgene_176681 | EGFP | Ae. Aegypti, Aequorea victoria | Ampicillin | PMID:34819517 | Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pSL1180; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:59 | 0 | |
|
MF87_PB-EF1a-TET3G-P2A-ERT2-Gal4-BGHpA Resource Report Resource Website |
RRID:Addgene_176630 | EF1a-TET3G-P2A-ERT2-Gal4-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:58 | 0 | ||
|
MF82_PB-TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA Resource Report Resource Website |
RRID:Addgene_176626 | TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:58 | 0 | ||
|
MF85_PB-14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA Resource Report Resource Website |
RRID:Addgene_176629 | 14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:58 | 0 | ||
|
MF84_PB-14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA Resource Report Resource Website |
RRID:Addgene_176628 | 14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA | Synthetic | Ampicillin | PMID:35050677 | Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:58 | 0 | ||
|
BL21 Rosetta2 GamS Resource Report Resource Website |
RRID:Addgene_176584 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-01 01:08:58 | 0 | ||
|
BL21 Rosetta2 ΔrecBCD Resource Report Resource Website |
RRID:Addgene_176583 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recBCD genomic deletion | 2026-08-01 01:08:58 | 0 | |
|
BL21 Rosetta2 ΔrecBCD GamS Resource Report Resource Website |
RRID:Addgene_176586 | pRARE2 + pBADmod1-linker2-gamS plasmid | Chloramphenicol and Ampicillin | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | recBCD genomic deletion | 2026-08-01 01:08:58 | 0 | |
|
pHS0537 CRISPR-associated IscB locus (Delaware Bay) in pBR322 with Fn spacer Resource Report Resource Website |
RRID:Addgene_176588 | CRISPR-associate IscB (Delaware Bay) locus | Delaware Bay metagenome | Ampicillin | PMID:34591643 | Backbone Marker:NEB; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | Replaced spacer in CRISPR array with Fn spacer | 2026-08-01 01:08:58 | 0 | |
|
BL21 Rosetta2 ΔrecB Resource Report Resource Website |
RRID:Addgene_176582 | pRARE2 plasmid | Chloramphenicol | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol | recB genomic deletion | 2026-08-01 01:08:58 | 0 | |
|
BL21 ΔrecBCD Resource Report Resource Website |
RRID:Addgene_176581 | This is a strain. | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recBCD genomic deletion | 2026-08-01 01:08:58 | 0 | |
|
pLib6.4-Aaeg_763 Resource Report Resource Website |
RRID:Addgene_176658 | Ampicillin | PMID:34819517 | Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. | Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-01 01:08:59 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.