Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 25 showing 481 ~ 500 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/22438

Species: Homo sapiens
Genetic Insert: F6
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039

Proper citation: RRID:Addgene_22438 Copy   


http://www.addgene.org/22439

Species: Homo sapiens
Genetic Insert: F6 Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: Sp1 mutation (−103) oligo is - GGATAGGGACTGGGCGAGG

Proper citation: RRID:Addgene_22439 Copy   


http://www.addgene.org/22434

Species: Homo sapiens
Genetic Insert: F4
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039

Proper citation: RRID:Addgene_22434 Copy   


http://www.addgene.org/22435

Species: Homo sapiens
Genetic Insert: F4 GATA mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: GATA mutation oigo - GCTCCCACTTTAGAGCCTCAGT

Proper citation: RRID:Addgene_22435 Copy   


http://www.addgene.org/22436

Species: Homo sapiens
Genetic Insert: F5
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039

Proper citation: RRID:Addgene_22436 Copy   


http://www.addgene.org/22431

Species: Homo sapiens
Genetic Insert: F3 GATA Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: The forward primer used for the Sp1 mutations (-103) was GGATAGGGACTGGGCGAGG. GATA mutation oigo - GCTCCCACTTTAGAGCCTCAGT.

Proper citation: RRID:Addgene_22431 Copy   


http://www.addgene.org/22432

Species: Homo sapiens
Genetic Insert: F3 Sp-1 mut
Vector Backbone Description: Backbone Size:5854; Vector Backbone:pGL2 enhancer; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7541039
Comments: Forward primer used to create Sp-1 mutation: GGATAGGGACTGGGCGAGG

Proper citation: RRID:Addgene_22432 Copy   


  • RRID:Addgene_22647

http://www.addgene.org/22647

Species: Homo sapiens
Genetic Insert: Human genomic PLP
Vector Backbone Description: Backbone Marker:Fermentas; Backbone Size:2862; Vector Backbone:pTZ19R; Vector Types:phagemid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2479017
Comments: Genomic DNA from an EMBL3 human genomic library. Contains 3' end of Exon1, Intron 1, Exon 2 and Intron 2

Proper citation: RRID:Addgene_22647 Copy   


  • RRID:Addgene_22649

http://www.addgene.org/22649

Species: Rattus norvegicus
Genetic Insert: Myelin Transcription Factor 1L
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2743; Vector Backbone:pGEM-3Z; Vector Types:Cloning and RNA Synthesis; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9373037
Comments: Used to make riboprobes by cutting with SmaI and transcribing with SP6 polymerase to give a 980 bp riboprobe for RNA analysis on Northern blots This Rat Myt1 DNA cloned by Hudson lab.

Proper citation: RRID:Addgene_22649 Copy   


  • RRID:Addgene_22539

    This resource has 10+ mentions.

http://www.addgene.org/22539

Species: Homo sapiens
Genetic Insert: BAP1
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732

Proper citation: RRID:Addgene_22539 Copy   


  • RRID:Addgene_22651

    This resource has 1+ mentions.

http://www.addgene.org/22651

Species: Mus musculus
Genetic Insert: Proteolipid Protein
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2867; Vector Backbone:pGEM3; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3469678
Comments: Contains entire coding region of the mouse PLP cDNA including part of the 5' UTR. Used to make riboprobes by transcribing with SP6 polymerase to give a 980 bp antisense riboprobe or transcribing with T7 polymerase to give a 980bp sense riboprobe for RNA analysis on Northern blots. This PLP DNA cloned by Hudson lab.

Proper citation: RRID:Addgene_22651 Copy   


  • RRID:Addgene_22629

http://www.addgene.org/22629

Species: Mus musculus
Genetic Insert: Ror2 delta Ig
Vector Backbone Description: Backbone Size:9226; Vector Backbone:pEF1a-myc/his A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19720827

Proper citation: RRID:Addgene_22629 Copy   


  • RRID:Addgene_22624

http://www.addgene.org/22624

Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1378839
Comments: Insert is 4200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-4200 to +85) in the correct orientation. Insert is a BamHI/HindIII from pJB010 This PLP DNA cloned by Hudson lab.

Proper citation: RRID:Addgene_22624 Copy   


  • RRID:Addgene_22625

http://www.addgene.org/22625

Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1378839
Comments: Insert is 30bp ) of the Human PLP 5' upstream, promoter region and Exon1 (-18 to +12) in the correct orientation. This PLP DNA cloned by Hudson lab.

Proper citation: RRID:Addgene_22625 Copy   


  • RRID:Addgene_22626

http://www.addgene.org/22626

Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1378839
Comments: Insert is 1200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-1088 to +85) in the correct orientation. Site 3 (bp -117 to -116) were mutated via Site-Directed Mutagenesis from GG to cc. This PLP DNA cloned by Hudson lab.

Proper citation: RRID:Addgene_22626 Copy   


  • RRID:Addgene_22588

    This resource has 1+ mentions.

http://www.addgene.org/22588

Species: Homo sapiens
Genetic Insert: USP50
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732

Proper citation: RRID:Addgene_22588 Copy   


  • RRID:Addgene_22623

http://www.addgene.org/22623

Species: Homo sapiens
Genetic Insert: human genomic PLP promoter region
Vector Backbone Description: Backbone Marker:R. McKinnon; Backbone Size:4728; Vector Backbone:p18CAT; Vector Types:CAT reporter plasmid; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1378839
Comments: Insert is 1200bp (approx) of the Human PLP 5' upstream, promoter region and Exon1 (-1088 to +85) in the correct orientation This PLP DNA cloned by Hudson lab.

Proper citation: RRID:Addgene_22623 Copy   


  • RRID:Addgene_22584

    This resource has 1+ mentions.

http://www.addgene.org/22584

Species: Homo sapiens
Genetic Insert: USP46
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732

Proper citation: RRID:Addgene_22584 Copy   


  • RRID:Addgene_22585

    This resource has 1+ mentions.

http://www.addgene.org/22585

Species: Homo sapiens
Genetic Insert: USP48
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732

Proper citation: RRID:Addgene_22585 Copy   


  • RRID:Addgene_22580

http://www.addgene.org/22580

Species: Homo sapiens
Genetic Insert: USP38
Vector Backbone Description: Backbone Marker:Harper_Lab; Backbone Size:6521; Vector Backbone:pDEST_LTR_N_FLAG_HA_IRES_puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19615732

Proper citation: RRID:Addgene_22580 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X