Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 25 showing 481 ~ 500 out of 739,423 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_176384

http://www.addgene.org/176384

Species: Homo sapiens
Genetic Insert: TRERF1 gRNA
Vector Backbone Description: Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:
Comments: gRNA sequence listed also includes (uncloned) PAM

Proper citation: RRID:Addgene_176384 Copy   


http://www.addgene.org/176619

Species: Synthetic
Genetic Insert: I-SceI sites, Tol2 repeats and Tn5-neo cassette
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-T; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:34751773
Comments:

Proper citation: RRID:Addgene_176619 Copy   


http://www.addgene.org/176577

Species: Aggregatibacter actinomycetemcomitans
Genetic Insert: Dispersin B
Vector Backbone Description: Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35379435
Comments:

Proper citation: RRID:Addgene_176577 Copy   


  • RRID:Addgene_176603

http://www.addgene.org/176603

Species: Homo sapiens
Genetic Insert: Cry2PHR-mCherry-IBAR-WH2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35987384
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_176603 Copy   


  • RRID:Addgene_176602

http://www.addgene.org/176602

Species: Homo sapiens
Genetic Insert: Cry2PHR-mCherry-IBAR
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35987384
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_176602 Copy   


  • RRID:Addgene_176604

http://www.addgene.org/176604

Species: Homo sapiens
Genetic Insert: IBAR-Cry2PHR-mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35987384
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint.

Proper citation: RRID:Addgene_176604 Copy   


  • RRID:Addgene_176563

http://www.addgene.org/176563

Species: Synthetic
Genetic Insert: TagRFP657
Vector Backbone Description: Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35314781
Comments: Please note: Plasmid contains E38G and L304S mutations in MET17. These mutations are not known to affect plasmid function.

Proper citation: RRID:Addgene_176563 Copy   


  • RRID:Addgene_176560

http://www.addgene.org/176560

Species: Synthetic
Genetic Insert: TagRFP657
Vector Backbone Description: Vector Backbone:pH; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35314781
Comments:

Proper citation: RRID:Addgene_176560 Copy   


http://www.addgene.org/176681

Species: Ae. Aegypti, Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pSL1180; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_176681 Copy   


http://www.addgene.org/176630

Species: Synthetic
Genetic Insert: EF1a-TET3G-P2A-ERT2-Gal4-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Comments:

Proper citation: RRID:Addgene_176630 Copy   


http://www.addgene.org/176626

Species: Synthetic
Genetic Insert: TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Comments:

Proper citation: RRID:Addgene_176626 Copy   


http://www.addgene.org/176629

Species: Synthetic
Genetic Insert: 14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Comments:

Proper citation: RRID:Addgene_176629 Copy   


http://www.addgene.org/176628

Species: Synthetic
Genetic Insert: 14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Comments:

Proper citation: RRID:Addgene_176628 Copy   


  • RRID:Addgene_176584

http://www.addgene.org/176584

Species:
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176584 Copy   


http://www.addgene.org/176583

Species:
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176583 Copy   


http://www.addgene.org/176586

Species:
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca

Proper citation: RRID:Addgene_176586 Copy   


http://www.addgene.org/176588

Species: Delaware Bay metagenome
Genetic Insert: CRISPR-associate IscB (Delaware Bay) locus
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34591643
Comments:

Proper citation: RRID:Addgene_176588 Copy   


  • RRID:Addgene_176582

http://www.addgene.org/176582

Species:
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag

Proper citation: RRID:Addgene_176582 Copy   


  • RRID:Addgene_176581

http://www.addgene.org/176581

Species:
Genetic Insert: This is a strain.
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc

Proper citation: RRID:Addgene_176581 Copy   


  • RRID:Addgene_176658

http://www.addgene.org/176658

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Cloning of sgRNA targeting sequence into BbsI cassette. Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_176658 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X