Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
|||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
pBS-F3-CGG Resource Report Resource Website |
RRID:Addgene_30737 | F3 CGG | Ampicillin | PMID:21937602 | Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:43 | 0 | |||
|
pNN4 Resource Report Resource Website |
RRID:Addgene_31010 | repeat NN4 | Xanthamonas oryzae | Tetracycline | PMID:21493687 | Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline | Addgene | 2026-11-07 01:13:44 | 0 | ||
|
pNN5 Resource Report Resource Website |
RRID:Addgene_31011 | repeat NN5 | Xanthamonas oryzae | Tetracycline | PMID:21493687 | Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline | Addgene | 2026-11-07 01:13:44 | 0 | ||
|
pNN8 Resource Report Resource Website |
RRID:Addgene_31014 | repeat NN8 | Xanthamonas oryzae | Tetracycline | PMID:21493687 | Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline | Addgene | 2026-11-07 01:13:44 | 0 | ||
|
pNN9 Resource Report Resource Website |
RRID:Addgene_31015 | repeat NN9 | Xanthamonas oryzae | Tetracycline | PMID:21493687 | Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline | Addgene | 2026-11-07 01:13:44 | 0 | ||
|
pBS-F2-GCC Resource Report Resource Website |
RRID:Addgene_30721 | F2 GCC | Ampicillin | PMID:21937602 | Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:43 | 0 | |||
|
pFUS_B1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31018 | LacZ + BsaI restriction sites | Spectinomycin | PMID:21493687 | Backbone Marker:Invitrogen; Backbone Size:2447; Vector Backbone:pCR8; Vector Types:; Bacterial Resistance:Spectinomycin | Addgene | 2026-11-07 01:13:44 | 1 | |||
|
pCS2-F2-GCT Resource Report Resource Website |
RRID:Addgene_30723 | F2 GCT | Danio rerio | Ampicillin | PMID:21937602 | Backbone Size:6141; Vector Backbone:pCS2; Vector Types:mRNA production; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:43 | 0 | ||
|
pCS2-F2-GCG Resource Report Resource Website |
RRID:Addgene_30722 | F2 GCG | Ampicillin | PMID:21937602 | Backbone Size:2877; Vector Backbone:pCS2 (modified); Vector Types:mRNA production; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:43 | 0 | |||
|
pFUS_B2 Resource Report Resource Website |
RRID:Addgene_31019 | LacZ + BsaI restriction sites | Spectinomycin | PMID:21493687 | Backbone Marker:Invitrogen; Backbone Size:2447; Vector Backbone:pCR8; Vector Types:; Bacterial Resistance:Spectinomycin | Addgene | 2026-11-07 01:13:44 | 0 | |||
|
pCS2-F2-GGC Resource Report Resource Website |
RRID:Addgene_30725 | F2 GGC | Ampicillin | PMID:21937602 | Backbone Size:2877; Vector Backbone:pCS2 (modified); Vector Types:mRNA production; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:43 | 0 | |||
|
pBS-F2-GTA Resource Report Resource Website |
RRID:Addgene_30727 | F2 GTA | Ampicillin | PMID:21937602 | Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:43 | 0 | |||
|
pcDNA3.1-Myc-His RTN3A1 Resource Report Resource Website |
RRID:Addgene_31087 | reticulon 3 | Homo sapiens | Ampicillin | PMID:17182608 | Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)B (invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:45 | 0 | ||
|
pD2eGFP-5xUTR Resource Report Resource Website |
RRID:Addgene_31121 | 5xoligonucleotides eGFPutr | Ampicillin | PMID:15919892 | GFPutrNotF oligo sequence - CGCAGCGGCCGCGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGAAT. This is similar to the reporter described in the manuscript, “pD2eGFP-6XUTR.” This is designed to be especially sensitive to regulation by the InvivoGen commercial GFP shRNA and therefore has 3 extra perfect complementary shRNA binding sites and one imperfect in the 3’ UTR for a total of 5 possible shRNA docking sites (1 in coding region, 4 in 3’ UTR). The pD2eGFP-5XUTR construct is similar to the pD2eGFP-6XUTR construct in its increased susceptibility to regulation by the InvivoGen shRNA. | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:45 | 0 | ||
|
pCMV:GFP(FRT)lacZ Resource Report Resource Website 1+ mentions |
RRID:Addgene_31124 | GFP(FRT)lacZ | Ampicillin | PMID:11376165 | FLP reporter: from green protein fluorescence to lacZ | Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, FLP/FRT; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:45 | 1 | ||
|
ACE2(-252)-luc Resource Report Resource Website |
RRID:Addgene_31111 | ACE2 promoter | Homo sapiens | Ampicillin | PMID:16297991 | promoter luciferase reporter Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid. | Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | promoter region -252 to +103 | Addgene | 2026-11-07 01:13:45 | 0 |
|
pLenti6-MK1-EHMT2-V5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31113 | euchromatic histone-lysine N-methyltransferase 2 | Homo sapiens | Ampicillin | Spektor TM, Rice JC. Identification and characterization of posttranslational modification-specific binding proteins in vivo by mammalian tethered catalysis. Proc Natl Acad Sci U S A. 2009 Sep 1;106(35):14808-13. Epub 2009 Aug 18. | Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Stop codon mutated to Ala | Addgene | 2026-11-07 01:13:45 | 4 | |
|
ACE2(-202)-luc Resource Report Resource Website |
RRID:Addgene_31112 | ACE2 promoter | Homo sapiens | Ampicillin | PMID:16297991 | promoter luciferase reporter Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid. | Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | promoter region -202 to +103 | Addgene | 2026-11-07 01:13:45 | 0 |
|
pSR-puro-RalBP1 Resource Report Resource Website |
RRID:Addgene_31115 | RalBP1 shRNA | Homo sapiens | Ampicillin | PMID:20145037 | shRNA RalBP1 sequence: 5′-GTAGAGAGGACCATGATGT-3' | Backbone Marker:Oligoengine; Backbone Size:6349; Vector Backbone:pSUPER.retro.puro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | Addgene | 2026-11-07 01:13:45 | 0 | |
|
FR_HNF4A8 Resource Report Resource Website 1+ mentions |
RRID:Addgene_31114 | HNF4A | Homo sapiens | Ampicillin | PMID:17214554 | for Flp mediated site directed integration, tetracycline inducibility | Backbone Marker:Invitrogen; Backbone Size:5137; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | splice variant 8 | Addgene | 2026-11-07 01:13:45 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
