Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: human IL-17 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5064; Vector Backbone:pGL3-Enhancer; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15459204
Proper citation: RRID:Addgene_25628 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25749 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25748 Copy
Species: Homo sapiens
Genetic Insert: human IL-17 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5064; Vector Backbone:pGL3-Enhancer; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15459204
Proper citation: RRID:Addgene_25629 Copy
Species: Homo sapiens
Genetic Insert: UBE2J2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2F4W http://www.thesgc.org/structures/2F4W/
Proper citation: RRID:Addgene_25624 Copy
Species: Homo sapiens
Genetic Insert: CAPN8
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2NQA http://www.thesgc.org/structures/2NQA/
Proper citation: RRID:Addgene_25623 Copy
Species: Mus musculus
Genetic Insert: Gb2
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:13217; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: Lentivirus; Inducible TRE driven GFP-shRNA (GB2); Constitutive Ubi-c driven rtTA3-IRES-Neo
GB2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25746 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Proper citation: RRID:Addgene_25740 Copy
Species: Homo sapiens
Genetic Insert: CAPN13
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2I7A http://www.thesgc.org/structures/2I7A/
Proper citation: RRID:Addgene_25622 Copy
Species: Homo sapiens
Genetic Insert: UEV3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2I6T http://www.thesgc.org/structures/2I6T/
Proper citation: RRID:Addgene_25621 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12752; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
Proper citation: RRID:Addgene_25742 Copy
Species: Homo sapiens
Genetic Insert: TORC1 (1-634)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14536081
Proper citation: RRID:Addgene_25718 Copy
Species: Mus musculus
Genetic Insert: MCL1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX4T-1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19433446
Proper citation: RRID:Addgene_25717 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Proper citation: RRID:Addgene_25675 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Proper citation: RRID:Addgene_25674 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #107
Proper citation: RRID:Addgene_25676 Copy
Species: Homo sapiens
Genetic Insert: E74-like factor 3 (ets domain transcription factor, epithelial-specific )
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:5200; Vector Backbone:pIRESpuro2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25728 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #828
Proper citation: RRID:Addgene_25689 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #824
Proper citation: RRID:Addgene_25686 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #827
Proper citation: RRID:Addgene_25688 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.