Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 237 showing 4721 ~ 4740 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_25608

http://www.addgene.org/25608

Species: Homo sapiens
Genetic Insert: SF3A1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1ZKH http://www.thesgc.org/structures/1ZKH/

Proper citation: RRID:Addgene_25608 Copy   


  • RRID:Addgene_25569

http://www.addgene.org/25569

Species: Plasmodium falciparum
Genetic Insert: Pf-PPWD1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 2FU0 http://www.thesgc.org/structures/2FU0/

Proper citation: RRID:Addgene_25569 Copy   


  • RRID:Addgene_25568

http://www.addgene.org/25568

Species: Plasmodium yoelii
Genetic Insert: Py-OAT
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1Z7D http://www.thesgc.org/structures/1Z7D/

Proper citation: RRID:Addgene_25568 Copy   


  • RRID:Addgene_25604

http://www.addgene.org/25604

Species: Homo sapiens
Genetic Insert: AMPKB2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2F15 http://www.thesgc.org/structures/2F15/

Proper citation: RRID:Addgene_25604 Copy   


  • RRID:Addgene_25567

http://www.addgene.org/25567

Species: Plasmodium yoelii
Genetic Insert: Py-PPI (PY00382)
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1Z81 http://www.thesgc.org/structures/1Z81/

Proper citation: RRID:Addgene_25567 Copy   


  • RRID:Addgene_25563

http://www.addgene.org/25563

Species: Cryptosporidium parvum
Genetic Insert: Cp-VPS29
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2A22 http://www.thesgc.org/structures/2A22/

Proper citation: RRID:Addgene_25563 Copy   


  • RRID:Addgene_25562

http://www.addgene.org/25562

Species: Cryptosporidium parvum
Genetic Insert: Cp-NTF2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1ZO2 http://www.thesgc.org/structures/1ZO2/

Proper citation: RRID:Addgene_25562 Copy   


  • RRID:Addgene_25535

http://www.addgene.org/25535

Species: Homo sapiens
Genetic Insert: PDXK
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2AJP http://www.thesgc.org/structures/2AJP/

Proper citation: RRID:Addgene_25535 Copy   


  • RRID:Addgene_25537

http://www.addgene.org/25537

Species: Homo sapiens
Genetic Insert: KIFC3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: There is an N108D amino acid change compared to NCBI sequence for 2H58. PDB: 2H58 http://www.thesgc.org/structures/2H58/

Proper citation: RRID:Addgene_25537 Copy   


  • RRID:Addgene_25532

http://www.addgene.org/25532

Species: Homo sapiens
Genetic Insert: KHK
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2HLZ http://www.thesgc.org/structures/2HLZ/

Proper citation: RRID:Addgene_25532 Copy   


  • RRID:Addgene_25534

http://www.addgene.org/25534

Species: Homo sapiens
Genetic Insert: RAB2B
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2A5J http://www.thesgc.org/structures/2A5J/

Proper citation: RRID:Addgene_25534 Copy   


  • RRID:Addgene_25547

http://www.addgene.org/25547

Species: Homo sapiens
Genetic Insert: CKMT2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2GL6 http://www.thesgc.org/structures/2GL6/

Proper citation: RRID:Addgene_25547 Copy   


  • RRID:Addgene_25549

http://www.addgene.org/25549

Species: Homo sapiens
Genetic Insert: KIF1C-FHA
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2G1L http://www.thesgc.org/structures/2G1L/

Proper citation: RRID:Addgene_25549 Copy   


  • RRID:Addgene_25548

    This resource has 1+ mentions.

http://www.addgene.org/25548

Species: Homo sapiens
Genetic Insert: KIF2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2GRY http://www.thesgc.org/structures/2GRY/

Proper citation: RRID:Addgene_25548 Copy   


  • RRID:Addgene_25542

http://www.addgene.org/25542

Species: Homo sapiens
Genetic Insert: RAB30
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2EW1 http://www.thesgc.org/structures/2EW1/

Proper citation: RRID:Addgene_25542 Copy   


  • RRID:Addgene_25545

http://www.addgene.org/25545

Species: Homo sapiens
Genetic Insert: RAB27B
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2F7S http://www.thesgc.org/structures/2F7S/

Proper citation: RRID:Addgene_25545 Copy   


  • RRID:Addgene_25540

http://www.addgene.org/25540

Species: Homo sapiens
Genetic Insert: ARL10C
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2AL7 http://www.thesgc.org/structures/2AL7/

Proper citation: RRID:Addgene_25540 Copy   


  • RRID:Addgene_25759

http://www.addgene.org/25759

Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA

Proper citation: RRID:Addgene_25759 Copy   


http://www.addgene.org/25634

Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:6775; Vector Backbone:pLP-LNCX (Clontech); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17060456

Proper citation: RRID:Addgene_25634 Copy   


  • RRID:Addgene_25755

    This resource has 10+ mentions.

http://www.addgene.org/25755

Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT

Proper citation: RRID:Addgene_25755 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X