Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: SF3A1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1ZKH http://www.thesgc.org/structures/1ZKH/
Proper citation: RRID:Addgene_25608 Copy
Species: Plasmodium falciparum
Genetic Insert: Pf-PPWD1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 2FU0 http://www.thesgc.org/structures/2FU0/
Proper citation: RRID:Addgene_25569 Copy
Species: Plasmodium yoelii
Genetic Insert: Py-OAT
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1Z7D http://www.thesgc.org/structures/1Z7D/
Proper citation: RRID:Addgene_25568 Copy
Species: Homo sapiens
Genetic Insert: AMPKB2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2F15 http://www.thesgc.org/structures/2F15/
Proper citation: RRID:Addgene_25604 Copy
Species: Plasmodium yoelii
Genetic Insert: Py-PPI (PY00382)
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1Z81 http://www.thesgc.org/structures/1Z81/
Proper citation: RRID:Addgene_25567 Copy
Species: Cryptosporidium parvum
Genetic Insert: Cp-VPS29
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2A22 http://www.thesgc.org/structures/2A22/
Proper citation: RRID:Addgene_25563 Copy
Species: Cryptosporidium parvum
Genetic Insert: Cp-NTF2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1ZO2 http://www.thesgc.org/structures/1ZO2/
Proper citation: RRID:Addgene_25562 Copy
Species: Homo sapiens
Genetic Insert: PDXK
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2AJP http://www.thesgc.org/structures/2AJP/
Proper citation: RRID:Addgene_25535 Copy
Species: Homo sapiens
Genetic Insert: KIFC3
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: There is an N108D amino acid change compared to NCBI sequence for 2H58.
PDB: 2H58 http://www.thesgc.org/structures/2H58/
Proper citation: RRID:Addgene_25537 Copy
Species: Homo sapiens
Genetic Insert: KHK
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2HLZ http://www.thesgc.org/structures/2HLZ/
Proper citation: RRID:Addgene_25532 Copy
Species: Homo sapiens
Genetic Insert: RAB2B
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2A5J http://www.thesgc.org/structures/2A5J/
Proper citation: RRID:Addgene_25534 Copy
Species: Homo sapiens
Genetic Insert: CKMT2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2GL6 http://www.thesgc.org/structures/2GL6/
Proper citation: RRID:Addgene_25547 Copy
Species: Homo sapiens
Genetic Insert: KIF1C-FHA
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2G1L http://www.thesgc.org/structures/2G1L/
Proper citation: RRID:Addgene_25549 Copy
Species: Homo sapiens
Genetic Insert: KIF2
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2GRY http://www.thesgc.org/structures/2GRY/
Proper citation: RRID:Addgene_25548 Copy
Species: Homo sapiens
Genetic Insert: RAB30
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2EW1 http://www.thesgc.org/structures/2EW1/
Proper citation: RRID:Addgene_25542 Copy
Species: Homo sapiens
Genetic Insert: RAB27B
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2F7S http://www.thesgc.org/structures/2F7S/
Proper citation: RRID:Addgene_25545 Copy
Species: Homo sapiens
Genetic Insert: ARL10C
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2AL7 http://www.thesgc.org/structures/2AL7/
Proper citation: RRID:Addgene_25540 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25759 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:6775; Vector Backbone:pLP-LNCX (Clontech); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17060456
Proper citation: RRID:Addgene_25634 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25755 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
