Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178072 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG
Proper citation: RRID:Addgene_178077 Copy
Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178075 Copy
Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178076 Copy
Species: Homo sapiens
Genetic Insert: ATP1A1 G6 T804N pegRNA + MTOR-F2108L pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178109 Copy
Genetic Insert: ATP1A1 G8 sgRNA + user-specified sgRNA
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: U6-sgRNA cassette derived from pX330-U6-Chimeric_BB-CBh-hSpCas9. New user-specified sgRNA can be cloned using the BbsI sites. This vector can be used for prime editing (PE3 nick sgRNAs) to co-target ATP1A1 (T804N) and a gene of interest. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178104 Copy
Genetic Insert: ATP1A1 G4 Q118R pegRNA + MTOR-F2108L pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G4_Q118R_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA) to co-target ATP1A1 (Q118R) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178102 Copy
Species: Homo sapiens
Genetic Insert: ATP1A1 G8 + MTOR nick exon-53 sgRNAs
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation E2419K. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178107 Copy
Genetic Insert: ATP1A1 G6 T804N pegRNA + MTOR-I2017T pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G6_T804N_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR hyperactivating mutation I2017T. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178108 Copy
Species: Homo sapiens
Genetic Insert: ATP1A1 G8 + MTOR nick intron-45 sgRNAs
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control PE3 nick sgRNAs vector derived from ATP1A1_G8_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (T804N) and MTOR to perform coselection for MTOR rapamycin resistance mutation F2108L. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178106 Copy
Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Proper citation: RRID:Addgene_178067 Copy
Genetic Insert: ATP1A1 G4 Q118R pegRNA + EBFP to EGFP pegRNA
Vector Backbone Description: Vector Backbone:pU6-pegRNA-GG-acceptor; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control pegRNA vector derived from ATP1A1_G4_Q118R_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G3_EBFP_Dual_sgRNA or PE3b in combination with ATP1A1_G3_EGFP_Dual_sgRNA) to co-target ATP1A1 (Q118R) and EBFP to perform coselection for EBFP to EGFP conversion. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178100 Copy
Species: Homo sapiens
Genetic Insert: WLS
Vector Backbone Description: Backbone Marker:Addgene (#51406); Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34587386
Proper citation: RRID:Addgene_178064 Copy
Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178136 Copy
Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178134 Copy
Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178135 Copy
Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178139 Copy
Species: Homo sapiens
Genetic Insert: ATP1A1 G3 + EBFP nick sgRNAs
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, Prime editing; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: Control PE3 nick sgRNAs vector derived from ATP1A1_G3_Dual_sgRNA. This vector can be used as a positive control for prime editing (PE3) to co-target ATP1A1 (Q118R) and EBFP to perform coselection for EBFP to EGFP conversion. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178094 Copy
Species: Homo sapiens
Genetic Insert: Halotag
Vector Backbone Description: Vector Backbone:pUC57-BsaI-Free; Vector Types:Donor vector; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_178132 Copy
Species: Homo sapiens
Genetic Insert: NPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
Vector Backbone Description: Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36207338
Comments: This plasmid is derived from eSpCas9(1.1) (Plasmid #71814) from Feng Zhang's lab. The 3x FLAG sequence was removed to prevent interference of the tag in western blot and immunoprecipitation applications. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.
Proper citation: RRID:Addgene_178091 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.