Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Putative signal peptide from Encephalitozoon intestinalis and GFP from Aequorea victoria
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.05.30.596468 for bioRxiv preprint.
Proper citation: RRID:Addgene_222984 Copy
Species: Discosoma sp.
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5222; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35783175
Comments: Additional citation: Liu, H., Schittny, V. and Nash, M.A., 2019. Removal of a conserved disulfide bond does not compromise mechanical stability of a VHH antibody complex. Nano letters, 19(8), pp.5524-5529.
Proper citation: RRID:Addgene_169138 Copy
Species: Putative signal peptide from Encephalitozoon intestinalis and GFP from Aequorea victoria
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.05.30.596468 for bioRxiv preprint.
Proper citation: RRID:Addgene_222975 Copy
Species: Staphylococcus epidermidis
Genetic Insert: Staphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
Vector Backbone Description: Backbone Size:5222; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35783175
Proper citation: RRID:Addgene_169133 Copy
Species: Staphylococcus epidermidis
Genetic Insert: Staphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
Vector Backbone Description: Backbone Size:5222; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35783175
Proper citation: RRID:Addgene_169134 Copy
Species: Homo sapiens
Genetic Insert: Htt103QdeltaP135-170
Vector Backbone Description: Backbone Size:6069; Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_224878 Copy
Species: Putative signal peptide from Encephalitozoon intestinalis and GFP from Aequorea victoria
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.05.30.596468 for bioRxiv preprint.
Proper citation: RRID:Addgene_222976 Copy
Vector Backbone Description: Backbone Size:6277; Vector Backbone:pRS416; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Comments: Low copy yeast expression empty vector with GAL1 promoter and YFP for C-terminal tagging. Perfect for cloning an insert with XbaI.
Proper citation: RRID:Addgene_224875 Copy
Species: Putative signal peptide from Encephalitozoon intestinalis and GFP from Aequorea victoria
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.05.30.596468 for bioRxiv preprint.
Proper citation: RRID:Addgene_222972 Copy
Species: Putative signal peptide from Encephalitozoon intestinalis and GFP from Aequorea victoria
Genetic Insert: sfGFP
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Please visit https://doi.org/10.1101/2024.05.30.596468 for bioRxiv preprint.
Proper citation: RRID:Addgene_222978 Copy
Species: Homo sapiens
Genetic Insert: GAPDH fused with RGG domain of TOP3B
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225477 Copy
Species: Homo sapiens
Genetic Insert: GNB1L
Vector Backbone Description: Vector Backbone:pLenti-CMV-Puro; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37541219
Proper citation: RRID:Addgene_224387 Copy
Species: Homo sapiens
Genetic Insert: GNB1L
Vector Backbone Description: Vector Backbone:pLenti-CMV-Puro; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37541219
Proper citation: RRID:Addgene_224388 Copy
Species: Homo sapiens
Genetic Insert: ROCK2
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225472 Copy
Species: Synthetic
Genetic Insert: GFP-IRES-mCherry
Vector Backbone Description: Backbone Marker:Marco Jost & Jonathan Weissman, Addgene plasmid #188899; Vector Backbone:pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37144468
Proper citation: RRID:Addgene_222118 Copy
Species: Synthetic
Genetic Insert: GFP-IRES-mCherry
Vector Backbone Description: Backbone Marker:Marco Jost & Jonathan Weissman, Addgene plasmid #188899; Vector Backbone:pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37144468
Proper citation: RRID:Addgene_222113 Copy
Species: Synthetic
Genetic Insert: GFP-IRES-mCherry
Vector Backbone Description: Backbone Marker:Marco Jost & Jonathan Weissman, Addgene plasmid #188899; Vector Backbone:pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37144468
Proper citation: RRID:Addgene_222112 Copy
Species: Homo sapiens
Genetic Insert: FXR1 isoform a
Vector Backbone Description: Backbone Marker:Mayr Lab; Vector Backbone:pcDNA3-puro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37961296
Comments: Resistant to shRNA TRCN0000164818 (target sequence CCAGCGAATCTCATCACAGTA). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
Proper citation: RRID:Addgene_225467 Copy
Vector Backbone Description: Backbone Size:6601; Vector Backbone:BluescriptIIKS+; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12054889
Comments: similar to GenBank: EU546815.1 vector pMQ2
Addgene QC found an indel near the 3' end of T7 promoter
Proper citation: RRID:Addgene_220738 Copy
Species: Homo sapiens
Genetic Insert: COX8A
Vector Backbone Description: Vector Backbone:pcs2-GFP-IRES-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38297121
Comments: Cloned into BsmBI digested pcs2-GFP-IRES-mCherry.
Proper citation: RRID:Addgene_226104 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
