Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBABEpuro GFP-LC3 Resource Report Resource Website 50+ mentions |
RRID:Addgene_22405 | microtubule-associated protein 1 light chain 3 beta | Rattus norvegicus | Ampicillin | PMID:18094039 | LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8. | Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:45 | 98 | |
|
pAc5.1B-lambdaN-HA-DmGW182 Resource Report Resource Website |
RRID:Addgene_22406 | gawky, variant A | Drosophila melanogaster | Ampicillin | PMID:16815998 | Backbone Marker:Elisa Izaurralde; Backbone Size:5459; Vector Backbone:pAc5.1B-lambdaN; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:45 | 0 | ||
|
pENTR/pTER shATM #2 (730-2) Resource Report Resource Website |
RRID:Addgene_22527 | sh Ataxia telangiectasia mutated | Kanamycin | shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979. | Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin | 2026-09-19 02:15:47 | 0 | |||
|
pLenti X1 Zeo/pTER shATM #2 (735-1) Resource Report Resource Website |
RRID:Addgene_22528 | sh Ataxia telangiectasia mutated | Bleocin (Zeocin) | shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979. | Backbone Size:5540; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-19 02:15:47 | 0 | |||
|
SFG.wtCNa_opt.IRES.eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_22489 | codon optimised wild type Calcineurin A | Homo sapiens | Ampicillin | PMID:19770360 | Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | Codon Optimised wtCNa | 2026-09-19 02:15:46 | 1 | |
|
pcDNA3-HA-PHLPP2 Resource Report Resource Website 10+ mentions |
RRID:Addgene_22403 | PHLPP2 | Homo sapiens | Ampicillin | PMID:17386267 | Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:45 | 10 | ||
|
eNOS S1179A Resource Report Resource Website 1+ mentions |
RRID:Addgene_22485 | eNOS S1179A | Ampicillin | PMID:10376602 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:46 | 2 | |||
|
ph2p Resource Report Resource Website 1+ mentions |
RRID:Addgene_22520 | MPyV VP2 | Murine Polyomavirus | Bleocin (Zeocin) | PMID:19750217 | First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm | Backbone Size:3973; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-19 02:15:46 | 1 | |
|
Dominant negative Hsp90 beta Resource Report Resource Website 1+ mentions |
RRID:Addgene_22480 | Dominant negative Hsp90 | Homo sapiens | Ampicillin | PMID:17975117 | Backbone Size:5400; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:46 | 4 | ||
|
GST-Hsp90 M(272-617) Resource Report Resource Website 1+ mentions |
RRID:Addgene_22482 | Hsp90alpha M domain | Homo sapiens | Ampicillin | PMID:11988487 | Backbone Size:4968; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:46 | 4 | ||
|
pCS2vegf165 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22417 | vegf | Danio rerio | Ampicillin | PMID:12110173 | Backbone Size:4000; Vector Backbone:pCS2+; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:45 | 1 | ||
|
pLenti X2 Hygro/pTER shATM #2 (w639-1) Resource Report Resource Website |
RRID:Addgene_22532 | sh Ataxia telangiectasia mutated | Ampicillin | shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979. | Backbone Size:8459; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:47 | 0 | |||
|
pAc-Neo-OVA Resource Report Resource Website 1+ mentions |
RRID:Addgene_22533 | OVA | Gallus gallus | Ampicillin | PMID:3261634 | The OVA cDNA was removed from pOVA(230) (McReynolds et al., 1978) by digestion with EcoRI and subcloned into the polylinker of pUG-1. This provided convenient BglII and HindIII restriction sites adjacent to the ovalbumin cDNA for direct subcloning into the BamHI-HindIII site of the pHBetaAPr-1-neo express vector. | Backbone Marker:Kedes Lab; Backbone Size:10200; Vector Backbone:pHBetaAPr-1-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:47 | 3 | |
|
Kif1bβ-pcDNA3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_22534 | Kif1bβ | Homo sapiens | Ampicillin | PMID:18334619 | Backbone Marker:Invitrogen; Backbone Size:5362; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | wt cDNA | 2026-09-19 02:15:47 | 1 | |
|
pCAG-hHIF1 alpha-IGd2 Resource Report Resource Website |
RRID:Addgene_22535 | hypoxia inducible factor 1 alpha | Homo sapiens | Ampicillin | PMID:19131628 | Backbone Size:6262; Vector Backbone:pCAG IGd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:47 | 0 | ||
|
WT-eNOS-RFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_22497 | WT eNOS | Ampicillin | PMID:17170139 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:46 | 3 | |||
|
pLenti X2 Zeo/pTER shGFP #1 (802-1) Resource Report Resource Website |
RRID:Addgene_22530 | sh Enhanced Green Fluorescent Protein #1 | Bleocin (Zeocin) | Backbone Size:5596; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-19 02:15:47 | 0 | ||||
|
SFG.wtCNb_opt.IRES.eGFP Resource Report Resource Website |
RRID:Addgene_22492 | Codon optimised wild type Calcineurin B | Homo sapiens | Ampicillin | PMID:19770360 | Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:46 | 0 | ||
|
SFG.CNa12_opt.IRES.eGFP Resource Report Resource Website |
RRID:Addgene_22490 | Codon optimised Calcineurin A mutant 12 | Homo sapiens | Ampicillin | PMID:19770360 | Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin | T351E; L354A | 2026-09-19 02:15:46 | 0 | |
|
pSicoR (Puro) NEMO shRNA1 Resource Report Resource Website |
RRID:Addgene_22505 | NEMO shRNA1 | Mus musculus | Ampicillin | PMID:19847165 | Mouse NEMO shRNA1 in pSicoReverse (Puromycin) forward oligo: TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC reverse oligo : TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA | Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin | 2026-09-19 02:15:46 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
