Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Rattus norvegicus
Genetic Insert: microtubule-associated protein 1 light chain 3 beta
Vector Backbone Description: Backbone Marker:Addgene plasmid # 1764; Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18094039
Comments: LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. Kabeya Y et al. (EMBO J. 2000 Nov 1. 19(21):5720-8.
Proper citation: RRID:Addgene_22405 Copy
Species: Drosophila melanogaster
Genetic Insert: gawky, variant A
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:5459; Vector Backbone:pAc5.1B-lambdaN; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16815998
Proper citation: RRID:Addgene_22406 Copy
Genetic Insert: sh Ataxia telangiectasia mutated
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2571; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979.
Proper citation: RRID:Addgene_22527 Copy
Genetic Insert: sh Ataxia telangiectasia mutated
Vector Backbone Description: Backbone Size:5540; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Bleocin (Zeocin)
Comments: shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979.
Proper citation: RRID:Addgene_22528 Copy
Species: Homo sapiens
Genetic Insert: codon optimised wild type Calcineurin A
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19770360
Proper citation: RRID:Addgene_22489 Copy
Species: Homo sapiens
Genetic Insert: PHLPP2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17386267
Proper citation: RRID:Addgene_22403 Copy
Genetic Insert: eNOS S1179A
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10376602
Proper citation: RRID:Addgene_22485 Copy
Species: Murine Polyomavirus
Genetic Insert: MPyV VP2
Vector Backbone Description: Backbone Size:3973; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:19750217
Comments: First reference to this plasmid was in:
Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6
Genbank style annotations can be found at:
http://home.ccr.cancer.gov/LCO/packaging.htm
Proper citation: RRID:Addgene_22520 Copy
Species: Homo sapiens
Genetic Insert: Dominant negative Hsp90
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.0; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17975117
Proper citation: RRID:Addgene_22480 Copy
Species: Homo sapiens
Genetic Insert: Hsp90alpha M domain
Vector Backbone Description: Backbone Size:4968; Vector Backbone:pGEX-4T3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11988487
Proper citation: RRID:Addgene_22482 Copy
Species: Danio rerio
Genetic Insert: vegf
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCS2+; Vector Types:zebrafish expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12110173
Proper citation: RRID:Addgene_22417 Copy
Genetic Insert: sh Ataxia telangiectasia mutated
Vector Backbone Description: Backbone Size:8459; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: shATM #2 was used successfully in Rodier et al.(2009) Nat.Cell Biol. 11(8):973-979.
Proper citation: RRID:Addgene_22532 Copy
Species: Gallus gallus
Genetic Insert: OVA
Vector Backbone Description: Backbone Marker:Kedes Lab; Backbone Size:10200; Vector Backbone:pHBetaAPr-1-neo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:3261634
Comments: The OVA cDNA was removed from pOVA(230) (McReynolds et al., 1978) by digestion with EcoRI and subcloned into the polylinker of pUG-1. This provided convenient BglII and HindIII restriction sites adjacent to the ovalbumin cDNA for direct subcloning into the BamHI-HindIII site of the pHBetaAPr-1-neo express vector.
Proper citation: RRID:Addgene_22533 Copy
Species: Homo sapiens
Genetic Insert: Kif1bβ
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5362; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18334619
Proper citation: RRID:Addgene_22534 Copy
Species: Homo sapiens
Genetic Insert: hypoxia inducible factor 1 alpha
Vector Backbone Description: Backbone Size:6262; Vector Backbone:pCAG IGd2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19131628
Proper citation: RRID:Addgene_22535 Copy
Genetic Insert: WT eNOS
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17170139
Proper citation: RRID:Addgene_22497 Copy
Genetic Insert: sh Enhanced Green Fluorescent Protein #1
Vector Backbone Description: Backbone Size:5596; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Bleocin (Zeocin)
Proper citation: RRID:Addgene_22530 Copy
Species: Homo sapiens
Genetic Insert: Codon optimised wild type Calcineurin B
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19770360
Proper citation: RRID:Addgene_22492 Copy
Species: Homo sapiens
Genetic Insert: Codon optimised Calcineurin A mutant 12
Vector Backbone Description: Backbone Size:7678; Vector Backbone:SFG; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19770360
Proper citation: RRID:Addgene_22490 Copy
Species: Mus musculus
Genetic Insert: NEMO shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19847165
Comments: Mouse NEMO shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA
Proper citation: RRID:Addgene_22505 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
