Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: pCMV Tag2b Bim S
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23283 Copy
Species: type I human T-cell leukemia virus (HTLV-I)
Genetic Insert: Tax(M20)
Vector Backbone Description: Backbone Marker:David Russells lab; Backbone Size:4900; Vector Backbone:pCMV4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2276622
Proper citation: RRID:Addgene_23285 Copy
Species: Homo sapiens
Genetic Insert: MPP4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23417 Copy
Species: Homo sapiens
Genetic Insert: FLJ23356
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23375 Copy
Species: Homo sapiens
Genetic Insert: PRKAR1B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23376 Copy
Species: Homo sapiens
Genetic Insert: MPP7
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23411 Copy
Species: Homo sapiens
Genetic Insert: LOC390877
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23373 Copy
Species: Homo sapiens
Genetic Insert: PGK1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23427 Copy
Species: Homo sapiens
Genetic Insert: CHKA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23428 Copy
Species: Homo sapiens
Genetic Insert: CDC2L6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23429 Copy
Species: Homo sapiens
Genetic Insert: CIB4
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23386 Copy
Species: Homo sapiens
Genetic Insert: PLK3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18519666
Comments: Please note that due to the presence of a 6xHis tag this plasmid appears to encode aa 2-327 for PLK3.
Proper citation: RRID:Addgene_23266 Copy
Species: Homo sapiens
Genetic Insert: MAPK8
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23420 Copy
Species: Homo sapiens
Genetic Insert: CDKL2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23421 Copy
Species: Homo sapiens
Genetic Insert: PLK3
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18519666
Proper citation: RRID:Addgene_23268 Copy
Species: Homo sapiens
Genetic Insert: CDKL1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23389 Copy
Species: Homo sapiens
Genetic Insert: CAMKK2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23422 Copy
Species: Homo sapiens
Genetic Insert: PRKX
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23383 Copy
Species: Homo sapiens
Genetic Insert: PHKG1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5005; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21107320
Comments: The ORF has no Stop codon. This design enables easy recombination into a destination vector to add an epitope tag of choice and Stop codon to the ORF. Do NOT use this plasmid directly for transfections.
A set of 4 custom lentiviral vectors is available ( pLX301 (http://www.addgene.org/25895/) , pLX302 (http://www.addgene.org/25896/) , pLX303 (http://www.addgene.org/25897/) , pLX304 (http://www.addgene.org/25890/) ) to be used to express these ORFs in mammalian cells. These plasmids are not included in the kit and must be ordered separately.
Proper citation: RRID:Addgene_23385 Copy
Species: Homo sapiens
Genetic Insert: poly(ADP-ribose) glycohydrolase shRNA
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:7032; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20068071
Comments: shRNA oligo sequence is - 5'-CCGGGCTGAGCGAGATGTGGTTTATCTCGAGATAAACCACATCTCGCTCAGCTTTTTG
Proper citation: RRID:Addgene_23260 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.