Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Caenorhabditis elegans
Genetic Insert: SnAvi
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:9674; Vector Backbone:EGFP-N1; Vector Types:Worm Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20047968
Comments: this plasmid encodes the new described SnAvi tag and additionally the unc-119 rescue sequence from C. elegans (bp4-5705)
Proper citation: RRID:Addgene_23223 Copy
Species: Homo sapiens
Genetic Insert: RhoA
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18614539
Proper citation: RRID:Addgene_23224 Copy
Species: Top10 E.coli, Discosoma sp.
Genetic Insert: BirA-mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3992; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20047968
Proper citation: RRID:Addgene_23220 Copy
Species: Helicobacter pylori
Genetic Insert: TNF-α-inducing protein
Vector Backbone Description: Backbone Size:5368; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19596016
Proper citation: RRID:Addgene_23159 Copy
Species: Helicobacter pylori
Genetic Insert: TNF-α-inducing protein
Vector Backbone Description: Backbone Size:5368; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19596016
Proper citation: RRID:Addgene_23157 Copy
Species: Helicobacter pylori
Genetic Insert: TNF-α-inducing protein
Vector Backbone Description: Backbone Size:5368; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19596016
Proper citation: RRID:Addgene_23158 Copy
Species: Mus musculus
Genetic Insert: mouse gammaF crystallin promoter:mCherry
Vector Backbone Description: Backbone Size:0; Vector Backbone:p817 (pBSII derivate); Vector Types:multicloning site flanked by I-SceI sites; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20359307
Comments: A=>G and G=>A mismatches in gene do not have any functional significance.
Proper citation: RRID:Addgene_23154 Copy
Genetic Insert: Ribonuclease assay sub2
Vector Backbone Description: Backbone Size:2997; Vector Backbone:pGEM-7Zf(+); Vector Types:in vitro transcription; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17889667
Proper citation: RRID:Addgene_23161 Copy
Species: Homo sapiens
Genetic Insert: DNA polymerase beta (K72A)
Vector Backbone Description: Backbone Marker:Clontech, modifed by Sobol Lab; Backbone Size:7100; Vector Backbone:pIRESpuroGWB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20068071
Proper citation: RRID:Addgene_23258 Copy
Species: Homo sapiens
Genetic Insert: N-methylpurine DNA glycosylase (N169D)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRESneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20068071
Proper citation: RRID:Addgene_23259 Copy
Species: Homo sapiens
Genetic Insert: p65
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:11533489
Proper citation: RRID:Addgene_23255 Copy
Species: Homo sapiens
Genetic Insert: RIF1 deletion construct
Vector Backbone Description: Backbone Marker:Didier Trono Lab; Backbone Size:10000; Vector Backbone:pHR'CMVGFPIREShygro_WSIN18; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15583028
Comments: Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence.
Proper citation: RRID:Addgene_23135 Copy
Species: Homo sapiens
Genetic Insert: DNA polymerase beta shRNA
Vector Backbone Description: Backbone Marker:SIB; Backbone Size:6400; Vector Backbone:pSIF-H1-copGFP; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20068071
Comments: shRNA oligo sequence is - 5’-ctggcagacgcaacctaatgggacttcctgtcagatcctattgggttgtgtctgccagttttt
Proper citation: RRID:Addgene_23256 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23096 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: yeast Histone H3-2 and Histone H4-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4348; Vector Backbone:pRS414 delta Afl III- Sma I; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12039950
Comments: HHT2 is Yeast ID YNL031C
HHF2 is Yeast ID YNL030W
HHT2 is gene ID 855700
HHF2 is gene ID 855701
Proper citation: RRID:Addgene_23097 Copy
Species: Mus musculus
Genetic Insert: mouse Gcn5 mRNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4473; Vector Backbone:pCMV-sport2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10675335
Proper citation: RRID:Addgene_23098 Copy
Species: Homo sapiens
Genetic Insert: p300
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12456660
Proper citation: RRID:Addgene_23252 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TD)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23092 Copy
Species: Mus musculus
Genetic Insert: Bim EL (TA)
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV-Tag2B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18498746
Proper citation: RRID:Addgene_23093 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Tpa1
Vector Backbone Description: Backbone Size:5443; Vector Backbone:pET21a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20040577
Comments: This construct has a mutation causing N565D in the aa sequence. The depositor does know the effect of this mutation. However, it is not part of the active site.
Proper citation: RRID:Addgene_23140 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
