Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Fgf10 promoter
Vector Backbone Description: Backbone Marker:ATTC; Backbone Size:6100; Vector Backbone:pXP1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12490567
Proper citation: RRID:Addgene_24994 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7767; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16750377
Proper citation: RRID:Addgene_25044 Copy
Species: Homo sapiens
Genetic Insert: a wild type human MAP1-LC3B fused with HcRed
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pCXN2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18000393
Proper citation: RRID:Addgene_24991 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7767; Vector Backbone:pcDNA-DEST53; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16750377
Proper citation: RRID:Addgene_25046 Copy
Species: Homo sapiens
Genetic Insert: a mutant human MAP1-LC3B fused with EYFP
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pCXN2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18000393
Proper citation: RRID:Addgene_24990 Copy
Species: Xenopus laevis
Genetic Insert: insulin-like growth factor 1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11709186
Comments: mRNA injection sense: cut with NotI, transcribe with Sp6
Anti-sense in situ probe: cut with EcoRI, transcribe with T7
PCR fragment of IGF1 (EcoRI-XhoI) from stage 27 cDNA inserted into pCS2 (EcoRI-XhoI).
Sense: 5'AAA GAA TTC ATG GAA ACA AAC AAC AAT
Antisense: 5'-TTT CTC GAG TTA CAT TCG GAA TCC TCG
Proper citation: RRID:Addgene_24967 Copy
Genetic Insert: Flp recombinase
Vector Backbone Description: Backbone Marker:Addgene Plasmid 11578; Backbone Size:6739; Vector Backbone:pSico; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20479239
Comments: pSico-Flpo allows for conditional (Cre-Lox), stable expression of shRNAs for RNA interference in cells and transgenic mice. Addition of Cre TURNS ON shRNA expression.
The shRNA coding oligos have to be cloned into the HpaI and XhoI restriction sites. Oligo design information can be found on the author's map or on the Jacks Lab website http://web.mit.edu/ccr/labs/jacks/protocols/pSico.html
Proper citation: RRID:Addgene_24969 Copy
Species: Xenopus laevis
Genetic Insert: Btg-X
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15879552
Comments: For sense mRNA cut with NotI, transcribe with SP6
For antisense cut with ClaI, transcribe with T7
Proper citation: RRID:Addgene_24964 Copy
Species: Xenopus laevis
Genetic Insert: labial
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1677215
Proper citation: RRID:Addgene_24965 Copy
Genetic Insert: pKW08-Lx-Int
Vector Backbone Description: Backbone Size:8535; Vector Backbone:pMC1M; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:20434484
Proper citation: RRID:Addgene_25015 Copy
Species: Xenopus laevis
Genetic Insert: Antivin
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16172975
Comments: For antisense cut with HindIII, transcribe with T7
For sense cut with NotI, transcribe with SP6
Proper citation: RRID:Addgene_24961 Copy
Genetic Insert: pMEND-Lx
Vector Backbone Description: Backbone Size:8798; Vector Backbone:pMINDLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20434484
Proper citation: RRID:Addgene_25010 Copy
Genetic Insert: pMIND-Lx
Vector Backbone Description: Backbone Size:8798; Vector Backbone:pSHKLx; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20434484
Proper citation: RRID:Addgene_25013 Copy
Species: Xenopus laevis
Genetic Insert: Frzb-1 HA
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9118218
Comments: For sense, cut with NotI, transcribe with SP6.
HA tag is cloned between Ser158 and Met159 of Frezzled by PCR. HA tag includes a AatII diagnostic site.
Proper citation: RRID:Addgene_24979 Copy
Species: Xenopus laevis
Genetic Insert: Chordin
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS-SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8001117
Comments: Partial 2.8 kB clone of the original Xenopus chordin cDNA lacking 3' portion.
For antisense cut with EcoRI, transcribe with T7
For Northern blot probe, cut with EcoRI and XhoI
Proper citation: RRID:Addgene_24975 Copy
Species: Mus musculus
Genetic Insert: twisted gastrulation
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11714670
Comments: mRNA injection sense: cut with NotI, transcribe with SP6
Contains the Xenopus Chordin signal peptide and the N terminus until Ala41, followed by a Flag tag sequence.
Proper citation: RRID:Addgene_24974 Copy
Species: Drosophila melanogaster
Genetic Insert: HPat
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:6080; Vector Backbone:pAc5.1B-EGFP; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20404111
Proper citation: RRID:Addgene_25029 Copy
Genetic Insert: CMV-miR-31 sponge
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5-CMV-d2eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.
Proper citation: RRID:Addgene_25025 Copy
Genetic Insert: synthetic miR-335 site
Vector Backbone Description: Backbone Marker:David Bartel, Addgene plasmid # 12179; Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Renilla luciferase reporter for miR-335 constructed by cloning oligo containing synthetic miR-335 binding site (GCCAGTGAGCTCTCAAGAGCAATAACGAAAAATGTACCGGTGCCAGT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
Proper citation: RRID:Addgene_25028 Copy
Genetic Insert: synthetic miR-206 site
Vector Backbone Description: Backbone Marker:David Bartel, Addgene plasmid # 12179; Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Renilla luciferase reporter for miR-206 constructed by cloning oligo containing synthetic miR-206 binding site (GCCATTGAGCTCTGGAATGTAAGGAAGTGTGTGGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
Proper citation: RRID:Addgene_25027 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
