Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 222 showing 4421 ~ 4440 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_107291

http://www.addgene.org/107291

Species: Homo sapiens
Genetic Insert: RINS1(mut)
Vector Backbone Description: Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28366620

Proper citation: RRID:Addgene_107291 Copy   


  • RRID:Addgene_107290

    This resource has 1+ mentions.

http://www.addgene.org/107290

Species: Homo sapiens
Genetic Insert: RINS1
Vector Backbone Description: Vector Backbone:C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28366620

Proper citation: RRID:Addgene_107290 Copy   


http://www.addgene.org/107326

Species: Synthetic
Genetic Insert: SpCas9-NmCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107326 Copy   


http://www.addgene.org/107325

Species: Synthetic
Genetic Insert: SpCas9-NmCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107325 Copy   


http://www.addgene.org/107324

Species: Synthetic
Genetic Insert: SpCas9-NmCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107324 Copy   


http://www.addgene.org/107322

Species: Synthetic
Genetic Insert: SpCas9-SaCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107322 Copy   


  • RRID:Addgene_107288

http://www.addgene.org/107288

Species: Takifugu rubripes (fish)
Genetic Insert: Interferon gamma
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5360; Vector Backbone:pET26b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29742458

Proper citation: RRID:Addgene_107288 Copy   


  • RRID:Addgene_107287

http://www.addgene.org/107287

Species: Oreochromis niloticus (fish)
Genetic Insert: Interferon gamma
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5360; Vector Backbone:pET26b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29742458

Proper citation: RRID:Addgene_107287 Copy   


http://www.addgene.org/107320

Species: Synthetic
Genetic Insert: SpCas9-SaCas9 fusion
Vector Backbone Description: Vector Backbone:pCSDest2; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107320 Copy   


  • RRID:Addgene_107286

http://www.addgene.org/107286

Species: Homo sapiens
Genetic Insert: Interferon gamma receptor 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3646; Vector Backbone:pMT-BiP-V5-His; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27599734
Comments: Crystal structure of the extracellular part of receptor 2 of human interferon gamma; PDB ID 5eh1; doi: 10.1107/S2059798316012237

Proper citation: RRID:Addgene_107286 Copy   


http://www.addgene.org/107328

Genetic Insert: VEGFA-TS3 sgRNA
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30451839

Proper citation: RRID:Addgene_107328 Copy   


  • RRID:Addgene_107262

http://www.addgene.org/107262

Genetic Insert: curT
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pBR322; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29357135
Comments: this plasmid has also been used in: Heinz et al., Plant Cell 2016, DOI: https://doi.org/10.1105/tpc.16.00491

Proper citation: RRID:Addgene_107262 Copy   


  • RRID:Addgene_107255

http://www.addgene.org/107255

Species: Synthetic
Genetic Insert: HU-FRB
Vector Backbone Description: Backbone Size:4313; Vector Backbone:pBR322; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29357135

Proper citation: RRID:Addgene_107255 Copy   


http://www.addgene.org/107253

Genetic Insert: RNA motif plasmid cloning backbone
Vector Backbone Description: Vector Backbone:pLEX; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29400715
Comments: Digest plasmid with BsmBI and ligate RNA motif of interest. The RNA motif of interest would be in the 3UTR and flanked by BoxB motifs. Oligo cloning can be performed similarly to sgRNA cloning. Primers to order: Primers (5'->3') F GCTT R AGCT Example to clone in motif IRE motif IRE motif: TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA Primers to order F: GCTT TAACACATTATCGGGAGCAGTGTCTTCCATAATGTATAA R: AGCT TTATACATTATGGAAGACACTGCTCCCGATAATGTGTTA

Proper citation: RRID:Addgene_107253 Copy   


  • RRID:Addgene_107272

http://www.addgene.org/107272

Genetic Insert: HPRT1_B Avr-TALEN (right)
Vector Backbone Description: Vector Backbone:ptCMV-136/63-VR; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29507284

Proper citation: RRID:Addgene_107272 Copy   


  • RRID:Addgene_107271

http://www.addgene.org/107271

Genetic Insert: HPRT1_B Avr-TALEN (left)
Vector Backbone Description: Vector Backbone:ptCMV-136/63-VR; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29507284

Proper citation: RRID:Addgene_107271 Copy   


  • RRID:Addgene_107269

http://www.addgene.org/107269

Species: Ogataea parapolymorpha
Genetic Insert: polycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
Vector Backbone Description: Backbone Marker:Juergens H et al. Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA expression plasmid; Backbone Size:10046; Vector Backbone:pUDP002 #103872; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29438517

Proper citation: RRID:Addgene_107269 Copy   


  • RRID:Addgene_107268

http://www.addgene.org/107268

Vector Backbone Description: Backbone Marker:Lucigen Corporation; Backbone Size:7648; Vector Backbone:pSmartBAC (EU101022.1); Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29897754
Comments: Also carries apramycin resistance cassette. Selection for chloramphenicol and/or apramycin resistance will maintain the plasmid.

Proper citation: RRID:Addgene_107268 Copy   


http://www.addgene.org/107267

Species: Homo sapiens
Genetic Insert: mCherry-eDHFR-Cdc42Q61L
Vector Backbone Description: Backbone Marker:Carmen Williams (Addgene plasmid #32374); Vector Backbone:pIVT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097549

Proper citation: RRID:Addgene_107267 Copy   


  • RRID:Addgene_107266

http://www.addgene.org/107266

Species: E.coli
Genetic Insert: mCherry-eDHFR
Vector Backbone Description: Backbone Marker:Carmen Williams (Addgene plasmid #32374); Vector Backbone:pIVT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29097549

Proper citation: RRID:Addgene_107266 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X