Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Tet1
Vector Backbone Description: Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, but the protein product retains catalytic function.
Proper citation: RRID:Addgene_102421 Copy
Species: Arabidopsis thaliana
Genetic Insert: LYK5
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102389 Copy
Species: Mus musculus
Genetic Insert: Tet1 catalytic domain mutant
Vector Backbone Description: Backbone Marker:Austin Smith (Addgene plasmid# 60432); Vector Backbone:pPB-hCMV1-hNANOG-IV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: The full length transcript 201 refers to the coding sequence (CDS) of Ensembl transcript Tet1-201 (transcript ID ENSMUST00000050826.13) or NCBI RefSeq NM_027384.1. This variant (isoform 2) lacks an alternate in-frame exon in the central coding region, compared to variant 1.
Proper citation: RRID:Addgene_102422 Copy
Genetic Insert: tetracyclin-transactivator (rtTA)
Vector Backbone Description: Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28504700
Comments: IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers:
Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC
Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG
Proper citation: RRID:Addgene_102423 Copy
Species: Homo sapiens
Genetic Insert: YTHDF2
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:27602518
Proper citation: RRID:Addgene_102275 Copy
Species: Arabidopsis thaliana
Genetic Insert: CBL5
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102397 Copy
Species: Arabidopsis thaliana
Genetic Insert: CBL6
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102398 Copy
Species: Arabidopsis thaliana
Genetic Insert: SNRK2.3
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102391 Copy
Species: Arabidopsis thaliana
Genetic Insert: CBL2
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102394 Copy
Species: Homo sapiens
Genetic Insert: sgHAL
Vector Backbone Description: Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852
Proper citation: RRID:Addgene_102315 Copy
Species: E. coli
Genetic Insert: Formaldehyde repressor protein (frmR)
Vector Backbone Description: Vector Backbone:pTR47m4; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28921510
Proper citation: RRID:Addgene_102436 Copy
Genetic Insert: cAMPr
Vector Backbone Description: Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511120
Proper citation: RRID:Addgene_102437 Copy
Species: Mus musculus
Genetic Insert: Ftcd
Vector Backbone Description: Vector Backbone:pWP1; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852
Proper citation: RRID:Addgene_102317 Copy
Genetic Insert: cAMPr
Vector Backbone Description: Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29511120
Proper citation: RRID:Addgene_102438 Copy
Species: Homo sapiens
Genetic Insert: DNMT3A1
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28923089
Proper citation: RRID:Addgene_102278 Copy
Species: Arabidopsis thaliana
Genetic Insert: CBL8
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102399 Copy
Species: Homo sapiens
Genetic Insert: sgFTCD_1
Vector Backbone Description: Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852
Proper citation: RRID:Addgene_102312 Copy
Species: Homo sapiens
Genetic Insert: sgFTCD_2
Vector Backbone Description: Vector Backbone:pLentiCRISPR; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995852
Proper citation: RRID:Addgene_102313 Copy
Species: Arabidopsis thaliana
Genetic Insert: TN3
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102407 Copy
Species: Arabidopsis thaliana
Genetic Insert: ARA6
Vector Backbone Description: Backbone Marker:Toulouse; Vector Backbone:pAMPAT split-YFP; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_102408 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.