Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308
Proper citation: RRID:Addgene_107134 Copy
Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308
Proper citation: RRID:Addgene_107133 Copy
Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308
Proper citation: RRID:Addgene_107132 Copy
Species: Homo sapiens
Genetic Insert: neurofibromin 2
Vector Backbone Description: Backbone Marker:GE Life Sciences; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626191
Comments: GST tag in frame with NF2 gene
Note: The NFS insert contains A190V and G302E mutations compared to the closest reference sequence (NP_000259.1). The depositor has confirmed that these do not affect plasmid function.
Proper citation: RRID:Addgene_107149 Copy
Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107146 Copy
Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA
pLKO TRC v2 library vector, Puro selection and eGFP expression.
Proper citation: RRID:Addgene_107145 Copy
Vector Backbone Description: Vector Backbone:pXPR_045; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_107144 Copy
Species: Homo sapiens
Genetic Insert: annexin A10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23715859
Proper citation: RRID:Addgene_107199 Copy
Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308
Proper citation: RRID:Addgene_107131 Copy
Genetic Insert: NLS::gp41-1-C-intein::cGAL(AD)
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308
Proper citation: RRID:Addgene_107130 Copy
Species: Homo sapiens
Genetic Insert: SMAD4
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hyg; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26898331
Proper citation: RRID:Addgene_107128 Copy
Genetic Insert: SMAD4
Vector Backbone Description: Vector Backbone:pLVX tight puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26898331
Proper citation: RRID:Addgene_107129 Copy
Species: Homo sapiens
Genetic Insert: RB del22
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Comments: EcoRI is an internal site as well. See author's map. To learn more about del22 mutant, see reference: Sellers WR, Rodgers JW, and Kaelin WG, PNAS 92:11544.
Proper citation: RRID:Addgene_10721 Copy
Species: Homo sapiens
Genetic Insert: RB
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Proper citation: RRID:Addgene_10720 Copy
Vector Backbone Description: Backbone Marker:Richard Sherwood Lab; Backbone Size:6059; Vector Backbone:sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30405244
Proper citation: RRID:Addgene_107186 Copy
Species: Danio rerio
Genetic Insert: AsCpf1
Vector Backbone Description: Vector Backbone:pT3TS; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29222508
Comments: Please visit https://doi.org/10.1101/156125 for bioRxiv preprint.
Proper citation: RRID:Addgene_107185 Copy
Species: Homo sapiens
Genetic Insert: KCNJ13
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pC1GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25921210
Proper citation: RRID:Addgene_107183 Copy
Species: Synthetic
Genetic Insert: xyl8.2
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322
Proper citation: RRID:Addgene_107216 Copy
Species: Synthetic
Genetic Insert: ecAT3.10
Vector Backbone Description: Backbone Marker:modified from Invitrogen; Backbone Size:5000; Vector Backbone:pCMV(MinDis) [variant of pDisplay]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29121644
Proper citation: RRID:Addgene_107215 Copy
Species: Synthetic
Genetic Insert: xyl8.1
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322
Proper citation: RRID:Addgene_107214 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.