Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 220 showing 4381 ~ 4400 out of 742,877 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.addgene.org/107134

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107134 Copy   

http://www.addgene.org/107133

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107133 Copy   

http://www.addgene.org/107132

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107132 Copy   

http://www.addgene.org/107149

Species: Homo sapiens
Genetic Insert: neurofibromin 2
Vector Backbone Description: Backbone Marker:GE Life Sciences; Vector Backbone:pGEX-6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29626191
Comments: GST tag in frame with NF2 gene Note: The NFS insert contains A190V and G302E mutations compared to the closest reference sequence (NP_000259.1). The depositor has confirmed that these do not affect plasmid function.

Proper citation: RRID:Addgene_107149 Copy   

    • RRID:Addgene_107146

    This resource has 1+ mentions.

http://www.addgene.org/107146

Species: Mus musculus
Genetic Insert: Ezh2
Vector Backbone Description: Backbone Size:6573; Vector Backbone:MSCV-IRES-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107146 Copy   

    • RRID:Addgene_107145

    This resource has 10+ mentions.

http://www.addgene.org/107145

Species: Synthetic
Genetic Insert: GFP + sgRNA for GFP
Vector Backbone Description: Vector Backbone:pXPR_047; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence is GGTGAACCGCATCGAGCTGA pLKO TRC v2 library vector, Puro selection and eGFP expression.

Proper citation: RRID:Addgene_107145 Copy   

    • RRID:Addgene_107144

http://www.addgene.org/107144

Vector Backbone Description: Vector Backbone:pXPR_045; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_107144 Copy   

    • RRID:Addgene_107199

http://www.addgene.org/107199

Species: Homo sapiens
Genetic Insert: annexin A10
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-N3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23715859

Proper citation: RRID:Addgene_107199 Copy   

http://www.addgene.org/107131

Genetic Insert: NLS::cGAL(DBD)::gp41-1-N-intein
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107131 Copy   

http://www.addgene.org/107130

Genetic Insert: NLS::gp41-1-C-intein::cGAL(AD)
Vector Backbone Description: Vector Backbone:pHW393; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29581308

Proper citation: RRID:Addgene_107130 Copy   

    • RRID:Addgene_107128

    This resource has 1+ mentions.

http://www.addgene.org/107128

Species: Homo sapiens
Genetic Insert: SMAD4
Vector Backbone Description: Vector Backbone:pLVX-IRES-Hyg; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26898331

Proper citation: RRID:Addgene_107128 Copy   

http://www.addgene.org/107129

Genetic Insert: SMAD4
Vector Backbone Description: Vector Backbone:pLVX tight puro; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26898331

Proper citation: RRID:Addgene_107129 Copy   

    • RRID:Addgene_10721

    This resource has 1+ mentions.

http://www.addgene.org/10721

Species: Homo sapiens
Genetic Insert: RB del22
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334
Comments: EcoRI is an internal site as well. See author's map. To learn more about del22 mutant, see reference: Sellers WR, Rodgers JW, and Kaelin WG, PNAS 92:11544.

Proper citation: RRID:Addgene_10721 Copy   

    • RRID:Addgene_10720

    This resource has 10+ mentions.

http://www.addgene.org/10720

Species: Homo sapiens
Genetic Insert: RB
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSG5L; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9420334

Proper citation: RRID:Addgene_10720 Copy   

http://www.addgene.org/107186

Vector Backbone Description: Backbone Marker:Richard Sherwood Lab; Backbone Size:6059; Vector Backbone:sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR); Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30405244

Proper citation: RRID:Addgene_107186 Copy   

    • RRID:Addgene_107185

http://www.addgene.org/107185

Species: Danio rerio
Genetic Insert: AsCpf1
Vector Backbone Description: Vector Backbone:pT3TS; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29222508
Comments: Please visit https://doi.org/10.1101/156125 for bioRxiv preprint.

Proper citation: RRID:Addgene_107185 Copy   

    • RRID:Addgene_107183

http://www.addgene.org/107183

Species: Homo sapiens
Genetic Insert: KCNJ13
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pC1GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25921210

Proper citation: RRID:Addgene_107183 Copy   

    • RRID:Addgene_107216

http://www.addgene.org/107216

Species: Synthetic
Genetic Insert: xyl8.2
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107216 Copy   

    • RRID:Addgene_107215

    This resource has 1+ mentions.

http://www.addgene.org/107215

Species: Synthetic
Genetic Insert: ecAT3.10
Vector Backbone Description: Backbone Marker:modified from Invitrogen; Backbone Size:5000; Vector Backbone:pCMV(MinDis) [variant of pDisplay]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29121644

Proper citation: RRID:Addgene_107215 Copy   

    • RRID:Addgene_107214

http://www.addgene.org/107214

Species: Synthetic
Genetic Insert: xyl8.1
Vector Backbone Description: Vector Backbone:pETMBPH; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:30018322

Proper citation: RRID:Addgene_107214 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch