Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5205; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46055 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4880; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46056 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5468; Vector Backbone:pUC18; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23166051
Comments: Addgene's quality control sequencing has identified a few discrepancies compared to the depositor's full sequence; these differences are not thought to affect plasmid function.
Proper citation: RRID:Addgene_46053 Copy
Species: Mus musculus
Genetic Insert: Notch1 (C-term)
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22797301
Proper citation: RRID:Addgene_46048 Copy
Species: Synthetic
Genetic Insert: unc-119 targeting sgRNA
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: gRNA target sequence GAATTTTCTGAAATTAAAGA
Proper citation: RRID:Addgene_46169 Copy
Species: Synthetic
Genetic Insert: codon optimized Cas9_SV40 NLS with intron
Vector Backbone Description: Backbone Size:2641; Vector Backbone:pUC57; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817069
Comments: Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_46168 Copy
Vector Backbone Description: Backbone Size:9909; Vector Backbone:pUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27694947
Proper citation: RRID:Addgene_46162 Copy
Species: Mus musculus
Genetic Insert: mCD8mCherry
Vector Backbone Description: Backbone Size:9929; Vector Backbone:pQUASp; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_46164 Copy
Vector Backbone Description: Backbone Marker:Gerry Rubin; Backbone Size:8151; Vector Backbone:pJFRC-7; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23817068
Proper citation: RRID:Addgene_46145 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "+2" reading frame starting from the exon.
This vector consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.
Proper citation: RRID:Addgene_46140 Copy
Genetic Insert: EGFP/mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, Tol2 zebrafish transgenic expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19415631
Comments: This reporter is controlled by a 2.3 kb regulatory sequence consisting of 0.2 kb Xenopus EF1alpha enhancer and 2.1 kb zebrafish beta-actin 2 sequence including the 1.5 kb enhancer/promoter sequence, the 1st exon (86 bp) and part of the 1st intron (490 bp). To generate a complete intron, the splice acceptor from the rabbit beta-globin gene was placed upstream of the EGFP reporter and a synthetic splice acceptor was placed upstream of the mCherry reporter. The synthetic splice acceptor contains the zebrafish consensus sequence along with intronic and exonic splice enhancers.
There are some discrepancies between Addgene's and the depositor's sequence--these do not affect plasmid function.
Proper citation: RRID:Addgene_46144 Copy
Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:5176; Vector Backbone:pPTGAL4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46136 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: GAL80
Vector Backbone Description: Backbone Size:8938; Vector Backbone:pQUAST; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46137 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "even" or "0" reading frame starting from the exon.
This vector consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.
Proper citation: RRID:Addgene_46138 Copy
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:stratagene; Vector Backbone:pBluescript II KS+; Vector Types:Cre/Lox, mutagenic gene trap for zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22908272
Comments: mCherry is in the "+1" reading frame starting from the exon.
This vector consists of a highly mutagenic gene trap contained within the FlEx cassette that can be stably inverted by both Cre and Flp recombinases. FRT/F3 and loxP/lox5171 are incompatible recombination sites used for the Flp and Cre recombinases, respectively, to stably invert the cassette. The reporter gene, mCherry, has its own initiation codon.
Proper citation: RRID:Addgene_46139 Copy
Species: Synthetic
Genetic Insert: QSco
Vector Backbone Description: Backbone Size:11431; Vector Backbone:pCasper4-tubulinP; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a single nucleotide mismatch at bp# 5036 in the tubulin promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.
Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46132 Copy
Species: Synthetic
Genetic Insert: G4BDMD-QFAD
Vector Backbone Description: Backbone Size:6445; Vector Backbone:pPAC5C-PL; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46091 Copy
Species: Synthetic
Genetic Insert: QF#7
Vector Backbone Description: Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.
Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46125 Copy
Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:11271; Vector Backbone:pCaSpeR-act5cB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please note that Addgene's sequencing results found a few mismatches/gaps in the actin5c promoter when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.
Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46126 Copy
Species: Synthetic
Genetic Insert: LexA-QF
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46123 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
